Phylogeny of Medicinal Phyllanthus Species in China Based on Nuclear ITS and Chloroplast atpB-rbcL Sequences and Multiplex PCR Detection Assay Analysis

• Abstract
• Abbreviations
• Introduction
• Materials and Methods
• Origin of plant materials and DNA extraction
• PCR amplification and sequencing
• Phylogenetic reconstruction
• Multiplex PCR
• Results
• Discussion
• Acknowledgements
• References

Abstract

Plants of the genus Phyllanthus are commonly used in India, China and Korea for medicinal purposes. Although they are widely cultivated and marketed, there has been uncertainty about the efficacy of different species. A prerequisite of Good Agricultural Practice (GAP) is the authentication of relevant species, and this is now made unequivocal by applying DNA sequence tools. In this study the phylogenetic relationships among 18 Phyllanthus species found in China were investigated by DNA sequence analyses of the nuclear internal transcribed spacers (ITS1 and ITS2) along with the combined chloroplast atpB and rbcL sequences. Cladistic analysis indicated that this genus is paraphyletic and strongly supports the notion that two problematic and confusing species, P. niruri and P. amarus, are two individual, albeit closely related, species. We have also developed an ITS rDNA-based multiplex PCR assay to differentiate three medicinally important species, P. amarus, P. niruri and P. urinaria.

Abbreviations

atpB:ATP synthase subunit B

cpDNA:chloroplast DNA

ITS:18S-26S internal transcribed spacer region

MP:maximum parsimony

NJ:neighbor-joining

nrDNA:nuclear DNA

rbcL:ribulose-1,5-bisphosphate carboxylase large subunit

Introduction

Phyllanthus is a large genus in the family Phyllanthaceae that comprises 10 subgenera, including at least 700 annual and biennial herbs, shrubs and trees. Although this angiosperm plant genus is distributed worldwide, it is especially abundant in tropical regions [1]; for example, 33 species have been identified in the southern (subtropical) region of China [2]. Phyllanthus are important medicinal plants whose properties have been recognized for centuries [1]; folkloric records indicate that Herba Phyllanthus was used for various medical purposes in ancient China, India and Egypt [3], [4]. In 1988, Thyagarajan et al. [5] reported that P. amarus possesses anti-hepatitis B virus (HBV) activity and it was subsequently suggested that this herb inhibits HBV mRNA transcription and replication [6]. Similarly, P. niruri (which has been frequently misidentified as P. amarus) was reported to inhibit human HIV replication [7]. For centuries the differentiation of these two species, particularly in their commonly used dried whole plant forms, has been problematic to researchers and herbal medicine practitioners [8]. In addition to their antiviral activities, the antitumor effects of Phyllanthus spp. have also been extensively studied. For example, extracts and bioactive constituents of P. urinaria have been shown to induce apoptosis in carcinoma cells and inhibit tumor growth [9], [10].

In view of the above, there is clearly a need for an unequivocal and universal test to differentiate and authenticate different Phyllanthus species. Phylogenetic studies have been greatly aided by recent advancements in molecular biology and genetics-based tree reconstruction algorithms [11], [12]. The ITS1 and ITS2 regions of ribosomal RNA (rRNA) have been used extensively in the phylogenetic examination of eukaryotic organisms because nucleotide variations in these regions provide sufficient discrimination power to resolve intrageneric relationships [13], [14]. More recently, the chloroplast-encoded ATP synthase subunit B (atpB) and ribulose-1,5-bisphosphate carboxylase large subunit (rbcL) genes have also provided some useful insights into the phylogeny of Phyllanthaceae [15], [16], [17].

In this study, we have sequenced and analyzed the nuclear ITS region and chloroplast rbcL and atpB genes of 18 Phyllanthus spp. from India, Hong Kong and southern China and used these sequences to determine the phylogenetic relationships between these species. The results obtained are in agreement with previous findings which indicated that Phyllanthus species are not a monophyletic group [16], [17]. Our findings confirm that two problematic species, P. amarus and P. niruri, are indeed independent taxa. Moreover, we have developed a universal ITS rDNA-based multiplex PCR assay that can successfully differentiate the three medicinally important species, P. amarus, P. niruri and P. urinaria.

Materials and Methods

Origin of plant materials and DNA extraction

18 Phyllanthus species were collected from various places of origin as listed in Table [1]. Morphological identification was carried out by Prof. Ping-To Li of the South China Agricultural University [2]. Voucher specimens for 14 of the taxa examined were deposited at the Herbarium of the Chinese University of Hong Kong. Total genomic DNA was extracted with the DNeasy Plant Mini kit (Qiagen) according to the manufacturer's instructions.

PCR amplification and sequencing

The primers used in this study were synthesized by Invitrogen, Japan. Primers for ITS amplification; ITS4 (TCCTCCGCTTATTGATATGC) and ITS5 (GGAAGTAAAAGTCGTAACAAGG) have been described previously [18]. Primers for atpB-F (CCCGGGGCAAGATGCCTAATA) and atpB-R (GTTTGCTTAACTCGTTGCGC), and rbcL-F (TTCAAGGCTGGTGTAAAAGA) and rbcL-R (AGCAGCTAGTTCATTACTCC) were used to amplify the atpB and rbcL chloroplast genes, respectively. PCR reactions were performed in 100 μL containing 50 ng DNA, PCR buffer [0.3 mM Tris-HCl pH 8.0, 1.5 mM KCl, 3.5 mM Mg(OAc)₂], 0.2 mM of each dNTP, 0.2 μM of each primer and 1 U of Taq DNA polymerase (Advantage II, Clontech; Palo Alto, CA, USA). The thermocycling profile was as follows: denaturation at 95 °C for 20 sec, followed by 25 cycles at 95 °C for 5 sec, 55 °C for 30 sec, 68 °C for 1 min, and elongation at 68 °C for 5 min. PCR products were analyzed by 1.5 % agarose gel electrophoresis and the remaining amplification products were purified and sequenced using the High Pure purification kit (Roche; Indianapolis, IN, USA) and the BigDye Cycle Sequencing Kit in an automated DNA sequencer ABI377 (Applied Biosystems; USA). The ITS sequence of Euphorbia milii, and the atpB-rbcL sequences of Breynia cernua, Sauropus thorelii, Savia bahamensis, Blotia leandriana, Bischofia javanica, Androstachys johnsonii and Phyllanthus nummulariifolius, P. lokohensis and P. calycinus were retrieved from the GenBank database (Table [1]).

Phylogenetic reconstruction

Nucleotide sequences were aligned using the ClustalW program (http://www.ebi.ac.uk/clustalw/) and adjusted manually in BioEdit (ver. 4.8.10). Maximum parsimony and bootstrap analyses were performed using PAUP* 4.6.2 [19]. Heuristic searches were performed with a tree-bisection-reconnection branch swapping algorithm. Support for the inferred clades was obtained by bootstrap (BS) analysis from 1000 replicates of the data set. The consistency index (CI), retention index (RI) and rescaled consistency index (RC) were computed from the most parsimonious trees obtained. Neighbor-joining (NJ) was performed to derive the distance matrices of the operational taxonomic units (OTUs).

Multiplex PCR

Multiplex PCR was performed in 100 μL containing 10 ng of template DNA and forward primers PAMA (TCGAAACCTGCATGGCAGC), PNIN (CAAGCGAGAACCCAACAGGCT) and PURI (GCTATACGCTCACTGCGAGT), and reverse primer ITSR (ACCCAGGCAGACGTGCCCTC). The thermocycling profile consisted of a denaturation step at 95 °C for 20 sec followed by 36 cycles at 95 °C for 5 sec, 62 °C for 30 sec and 68 °C for 30 sec; and a final elongation step of 5 min at 68 °C. PCR products were analyzed in a 1.5 % agarose gel. In the multiplex PCR, identical mixture contents and temperature profiles as in the species-specific examinations were used, except that the primers were replaced by an optimized combination (100 nM each of PAMA and PURI, 50 nM of PNIN, 75 nM of ITS5 and 200 nM of ITSR).

Results

The ITS sequences of 18 Phyllanthus species, which ranged between 571 and 597 bp in length, were aligned with those of Breynia fruticosa (609 bp) and Euphorbia milii (649 bp), and sequence divergence was found to range between 0.0 (P. virgatus and P. clarkei; P. taxodiifolius and P. parvifolius) and 24.4 % (P. cochinchinensis and P. urinaria). Of the total of 686 characters examined, 208 are parsimony informative. Phylogenetic relationships among the Phyllanthus species were subsequently analyzed using maximum parsimony (MP) and neighbor-joining (NJ) methods with Euphorbia milii (Euphorbiaceae) as the outgroup taxon. MP searches yielded one most parsimonious tree of 3,388 steps with consistency (CI), retention (RI) and rescaled consistency (RC) indices of 0.677, 0.716 and 0.485, respectively (Fig. [1]). An identical tree topology was obtained using the NJ method (data not shown). Breynia fruticosa formed a sister group with P. taxodiifolius, P. emblica, P. parvifolius, P. urinaria and P. ussuriensis, which was supported by a bootstrap (BS) value of 73 %. From the 11 subclades shown in the MP-derived tree (Fig. [1]), 10 Phyllanthus species were chosen for the chloroplast DNA study along with Breynia fruticosa.

The atpB and rbcL chloroplast (cp) genes were PCR-amplified from 11 Phyllanthaceous species and the DNA sequences aligned with those of Breynia cernua, Sauropus sp. Tokuoka 267, Savia bahamensis, Blotia leandriana, Bischofia javanica, Phyllanthus nummulariifolius, P. lokohensis, P. calycinus and Androstachys johnsonii (obtained from the GenBank database; Table [1]). A low sequence divergence was observed for the combined Phyllanthus atpB-rbcL sequences which ranged from 0.0 (P. virgatus and P. nummulariifolius) to 3.3 (P. cochinchinensis and P. calycinus) (see Supporting Information). The combined cpDNA dataset resulted in a matrix of 2185 with 142 parsimony-informative sites (Table [2]).

The combined atpB and rbcL partial gene sequences were analyzed by means of maximum parsimony, resulting in an MP tree of 2,438 steps with low homoplasy (CI = 0.851, RI = 0.811, RC = 0.690) (Fig. [2]). NJ analysis produced a tree of similar topology (data not shown). Based on the MP tree, the 19 Phyllanthaceous taxa were divided into seven major clades, and P. amarus, P. virgatus and P. niruri were found to be closely related (bootstrap value > 95 %). It is noteworthy that, while P. emblica and P. urinaria clustered with Breynia and Sauropus, P. guandongensis, P. ruber, P. calycinus, P. reticulatus and P. glaucus formed a separate cluster with high bootstrap support (100 %). In contrast, P. cochinchinensis did not cluster with any of the Phyllanthus clades.

Based on multiple sequence alignment of the ITS sequences, the species-specific forward primers PURI, PNIN and PAMA, targeting the highly variable ITS1 regions of P. urinaria, P. niruri and P. amarus, respectively, were designed, along with a common reverse primer targeting the 5.8S rDNA (Supporting Information). To verify the specificity of these primers, PCR was performed on total DNA from 19 Phyllanthaceous species. Under carefully controlled conditions, species-specific amplicons of 220, 290 and 370 bp were obtained for P. niruri, P. urinaria and P. amarus, respectively (Fig. [3]). Due to high sequence similarity between P. amarus and P. arenarius (3 polymorphic sites within the 590-bp ITS sequence), and between P. urinaria and P. ussuriensis (12 polymorphic sites within the 593-bp ITS sequence), PCR products of the same size were also amplified from total DNA of P. arenarius and P. ussuriensis using P. amarus- and P. urinaria-specific primer pairs, respectively. Next, in combination with primer ITS5 (an 18S-rDNA-based genus-specific primer), a multiplex PCR assay was optimized for the specific detection and differentiation of P. niruri, P. urinaria, P. amarus (Fig. [3]).

Discussion

Classification of the genus Phyllanthus has long been controversial as this genus shares many overlapping vegetative and floral characters with other members of the Phyllanthaceae and Euphorbiaceae [15], and very few morphological characters can be designated as representative indicators for identification purposes. In recent years, P. amarus, P. niruri, P. emblica and P. urinaria have attracted considerable attention because of their pharmacological properties. However, collecting Phyllanthus plants for therapeutic purposes without a means of proper species identification could lead to severe problems as many Euphorbiaceous plants are toxic. In the present study, the evolutionary relationships among several major Phyllanthus species collected in China, as well as nine other taxa obtained from the GenBank database, were examined using nuclear ITS and chloroplast atpB and rbcL sequences. Maximum parsimony analysis produced a consensus tree that supported the idea that the Phyllanthus subgenus is paraphyletic, and agreed with the earlier findings of Kathriarachchi et al. [17]. Interestingly, some therapeutically important Breynia and Sauropus species clustered with the two medicinal species P. emblica and P. urinaria (Fig. [2]). Moreover, it was found that P. amarus and P. niruri are likely independent taxa despite the fact that both are morphologically very similar [20].

Based on sequence alignment of multiple ITS sequences from diverse Phyllanthus taxa, three oligonucleotide primers (PAMA, PNIN and PURI) targeting highly variable regions of the ITS regions of P. amarus, P. niruri and P. urinaria were designed. The specificity of the primers were verified by PCR analysis and they were used to develop a multiplex PCR-based assay that allows universal, rapid and accurate differentiation of these three commercially important Phyllanthus species. The multiplex PCR assay is reliable and requires only a small quantity (10 ng) of template DNA (Fig. [3]). This property of the assay is especially important in the case of samples that contain degraded DNA, such as dried samples. In this case, nested PCR can be performed using species-specific primer sets to reduce the possibility of false-negative results as long as the ITS5-ITSR fragment is amplifiable.

In conclusion, based on analysis of nuclear ITS and chloroplast atpB-rbcL sequences and the inferred phylogeny, we demonstrated that the genus Phyllantus is paraphyletic. Additionally, a rapid, sensitive and cost-effective multiplex PCR assay is now available for the universal and unequivocal differentiation of the three medicinally important Phyllanthus species P. amarus, P. niruri and P. urinaria.

Acknowledgements

We are grateful to Dr. Theresa Kwong for her helpful advice and technical support. This study was supported by a Hong Kong SAR Government University Grants Committee - Area of Excellence Grant.

References

• 1 Unander D W, Webster G L, Blumberg B S. Records of usage or assays in Phyllanthus (Euphorbiaceae) I. subgenera Isocladus, Kirganelia, Cicca and Emblica .  J Ethnopharmacol. 1990;  30 233-64
  CrossrefPubMedSearch in Google Scholar
• 2 Li P T. Family Euphorbiaceae.  In: Flora of Reipublicae Popularis Sinicae. Volume 44, Part 2 Beijing; Science Press 1994: pp 78-116
  Search in Google Scholar
• 3 Bandyopadhyay S K, Pakrashi S C, Pakrashi A. The role of antioxidant activity of Phyllanthus emblica fruits on prevention from indomethacin induced gastric ulcer.  J Ethnopharmacol. 2000;  70 171-6
  CrossrefPubMedSearch in Google Scholar
• 4 Shen Z Q, Dong Z J, Peng H, Liu J K. Modulation of PAI-1 and tPA activity and thrombolytic effects of corilagin.  Planta Med. 2003;  69 1109-12
  Thieme ConnectPubMedSearch in Google Scholar
• 5 Thyagarajan S P, Subramanian S, Thirunalasundari T, Venkateswaran P S, Blumberg B S. Effect of Phyllanthus amarus on chronic carriers of hepatitis B virus.  Lancet. 1988;  2 764-6
  PubMedSearch in Google Scholar
• 6 Lee C D, Ott M, Thyagarajan S P, Shafritz D A, Burk R D, Gupta S. Phyllanthus amarus down-regulates hepatitis B virus mRNA transcription and replication.  Eur J Clin Invest. 1996;  26 1069-76
  CrossrefPubMedSearch in Google Scholar
• 7 Notka F, Meier G R, Wagner R. Inhibition of wild-type human immunodeficiency virus and reverse transcriptase inhibitor-resistant variants by Phyllanthus amarus .  Antiviral Res. 2003;  58 175-86
  CrossrefPubMedSearch in Google Scholar
• 8 Unander D W, Webster G L, Blumberg B S. Uses and bioassays in Phyllanthus (Euphorbiaceae): a compilation II. The subgenus Phyllanthus .  J Ethnopharmacol. 1991;  34 97-133
  CrossrefPubMedSearch in Google Scholar
• 9 Huang S T, Yang R C, Yang L J, Lee P N, Pang J HS. Phyllanthus urinaria triggers the apoptosis and Bcl-2 down-regulation in Lewis lung carcinoma cells.  Life Sci. 2003;  72 1705-16
  CrossrefPubMedSearch in Google Scholar
• 10 Giridharan P, Somasundaram S T, Perumal K, Vishwakarma R A, Karthikeyan N P, Velmurugan R. et al . Novel substituted methylenedioxy lignan suppresses proliferation of cancer cells by inhibiting telomerase and activation of c-myc and caspases leading to apoptosis.  Br J Cancer. 2002;  87 98-105
  CrossrefPubMedSearch in Google Scholar
• 11 Wang F, Chien N, Zhang Y, Yang H. Pollen flora of China. 2nd edition Beijing; Science Press 1997: pp 178-89
  Search in Google Scholar
• 12 Ma X Q, Duan J A, Zhu D Y, Dong T TX, Tsim K WK. Species identification of Huangqi (Radix Astragali) by DNA sequence of its 5S rRNA spacer domain.  Phytochemistry. 2000;  54 363-8
  CrossrefPubMedSearch in Google Scholar
• 13 Lau D TW, Shau P C, Wang J, But P PH. Authentication of medicinal Dendrobium species by the internal transcribed spacer of ribosomal DNA.  Planta Med. 2001;  67 456-60
  Thieme ConnectPubMedSearch in Google Scholar
• 14 Kuo H C, Su Y L, Yang H L, Chen T Y. Identification of Chinese medicinal fungus Cordyceps sinensis by PCR-single-stranded conformation polymorphism and phylogenetic relationship.  J Agric Food Chem. 2005;  53 3963-8
  CrossrefPubMedSearch in Google Scholar
• 15 APG (The Angiosperm Phylogeny Group). An update of the Angiosperm phylogeny group classification for the orders and families of flowering plants: APG II. Bot J Linn Soc 2003 141: 399-436
  Search in Google Scholar
• 16 Wurdack K J, Hoffmann P, Samuel R, de Brujin A van der, Bank M, Chase M W. Molecular phylogenetic analysis of Phyllanthaceae (Phyllanthoideae pro parte, Euphorbiaceae sensu lato) using plastid rbcL DNA sequences.  Am J Bot. 2004;  91 1882-900
  PubMedSearch in Google Scholar
• 17 Kathriarachchi H, Hoffmann P, Samuel R, Wurdack K J, Chase M W. Molecular phylogenetics of Phyllanthaceae inferred from five genes (plastid atpB, matK, 3'ndhF, rbcL, and nuclear PHYC).  Mol Phylogenet Evol. 2005;  36 112-34
  PubMedSearch in Google Scholar
• 18 White T J, Bruns T, Lee S, Taylor J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis M, Gelfand D, Sninsky J, White TJ, editors PCR protocols: a guide to methods and application. San Diego; Academic Press 1990: pp 315-22
  Search in Google Scholar
• 19 Swofford D L. PAUP*: phylogenetic analysis using parsimony (*and other methods). Massachusetts; Sinauer Associates, Inc. 1998
  Search in Google Scholar
• 20 Webster G L. A monographic study of the West Indian species of Phyllanthus .  J Arnold Arbor. 1957;  38 295-373
  PubMedSearch in Google Scholar

Prof. Wang-Fun Fong

Bioactive Products Research Group

Department of Biology and Chemistry

City University of Hong Kong

Hong Kong SAR

People's Republic of China

Phone: +852-2788-7406

Fax: +852-2788-7406

Email: bhwffong@cityu.edu.hk

References

• 1 Unander D W, Webster G L, Blumberg B S. Records of usage or assays in Phyllanthus (Euphorbiaceae) I. subgenera Isocladus, Kirganelia, Cicca and Emblica .  J Ethnopharmacol. 1990;  30 233-64
  CrossrefPubMedSearch in Google Scholar
• 2 Li P T. Family Euphorbiaceae.  In: Flora of Reipublicae Popularis Sinicae. Volume 44, Part 2 Beijing; Science Press 1994: pp 78-116
  Search in Google Scholar
• 3 Bandyopadhyay S K, Pakrashi S C, Pakrashi A. The role of antioxidant activity of Phyllanthus emblica fruits on prevention from indomethacin induced gastric ulcer.  J Ethnopharmacol. 2000;  70 171-6
  CrossrefPubMedSearch in Google Scholar
• 4 Shen Z Q, Dong Z J, Peng H, Liu J K. Modulation of PAI-1 and tPA activity and thrombolytic effects of corilagin.  Planta Med. 2003;  69 1109-12
  Thieme ConnectPubMedSearch in Google Scholar
• 5 Thyagarajan S P, Subramanian S, Thirunalasundari T, Venkateswaran P S, Blumberg B S. Effect of Phyllanthus amarus on chronic carriers of hepatitis B virus.  Lancet. 1988;  2 764-6
  PubMedSearch in Google Scholar
• 6 Lee C D, Ott M, Thyagarajan S P, Shafritz D A, Burk R D, Gupta S. Phyllanthus amarus down-regulates hepatitis B virus mRNA transcription and replication.  Eur J Clin Invest. 1996;  26 1069-76
  CrossrefPubMedSearch in Google Scholar
• 7 Notka F, Meier G R, Wagner R. Inhibition of wild-type human immunodeficiency virus and reverse transcriptase inhibitor-resistant variants by Phyllanthus amarus .  Antiviral Res. 2003;  58 175-86
  CrossrefPubMedSearch in Google Scholar
• 8 Unander D W, Webster G L, Blumberg B S. Uses and bioassays in Phyllanthus (Euphorbiaceae): a compilation II. The subgenus Phyllanthus .  J Ethnopharmacol. 1991;  34 97-133
  CrossrefPubMedSearch in Google Scholar
• 9 Huang S T, Yang R C, Yang L J, Lee P N, Pang J HS. Phyllanthus urinaria triggers the apoptosis and Bcl-2 down-regulation in Lewis lung carcinoma cells.  Life Sci. 2003;  72 1705-16
  CrossrefPubMedSearch in Google Scholar
• 10 Giridharan P, Somasundaram S T, Perumal K, Vishwakarma R A, Karthikeyan N P, Velmurugan R. et al . Novel substituted methylenedioxy lignan suppresses proliferation of cancer cells by inhibiting telomerase and activation of c-myc and caspases leading to apoptosis.  Br J Cancer. 2002;  87 98-105
  CrossrefPubMedSearch in Google Scholar
• 11 Wang F, Chien N, Zhang Y, Yang H. Pollen flora of China. 2nd edition Beijing; Science Press 1997: pp 178-89
  Search in Google Scholar
• 12 Ma X Q, Duan J A, Zhu D Y, Dong T TX, Tsim K WK. Species identification of Huangqi (Radix Astragali) by DNA sequence of its 5S rRNA spacer domain.  Phytochemistry. 2000;  54 363-8
  CrossrefPubMedSearch in Google Scholar
• 13 Lau D TW, Shau P C, Wang J, But P PH. Authentication of medicinal Dendrobium species by the internal transcribed spacer of ribosomal DNA.  Planta Med. 2001;  67 456-60
  Thieme ConnectPubMedSearch in Google Scholar
• 14 Kuo H C, Su Y L, Yang H L, Chen T Y. Identification of Chinese medicinal fungus Cordyceps sinensis by PCR-single-stranded conformation polymorphism and phylogenetic relationship.  J Agric Food Chem. 2005;  53 3963-8
  CrossrefPubMedSearch in Google Scholar
• 15 APG (The Angiosperm Phylogeny Group). An update of the Angiosperm phylogeny group classification for the orders and families of flowering plants: APG II. Bot J Linn Soc 2003 141: 399-436
  Search in Google Scholar
• 16 Wurdack K J, Hoffmann P, Samuel R, de Brujin A van der, Bank M, Chase M W. Molecular phylogenetic analysis of Phyllanthaceae (Phyllanthoideae pro parte, Euphorbiaceae sensu lato) using plastid rbcL DNA sequences.  Am J Bot. 2004;  91 1882-900
  PubMedSearch in Google Scholar
• 17 Kathriarachchi H, Hoffmann P, Samuel R, Wurdack K J, Chase M W. Molecular phylogenetics of Phyllanthaceae inferred from five genes (plastid atpB, matK, 3'ndhF, rbcL, and nuclear PHYC).  Mol Phylogenet Evol. 2005;  36 112-34
  PubMedSearch in Google Scholar
• 18 White T J, Bruns T, Lee S, Taylor J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis M, Gelfand D, Sninsky J, White TJ, editors PCR protocols: a guide to methods and application. San Diego; Academic Press 1990: pp 315-22
  Search in Google Scholar
• 19 Swofford D L. PAUP*: phylogenetic analysis using parsimony (*and other methods). Massachusetts; Sinauer Associates, Inc. 1998
  Search in Google Scholar
• 20 Webster G L. A monographic study of the West Indian species of Phyllanthus .  J Arnold Arbor. 1957;  38 295-373
  PubMedSearch in Google Scholar

Prof. Wang-Fun Fong

Bioactive Products Research Group

Department of Biology and Chemistry

City University of Hong Kong

Hong Kong SAR

People's Republic of China

Phone: +852-2788-7406

Fax: +852-2788-7406

Email: bhwffong@cityu.edu.hk

• Supplementary Material