Subscribe to RSS
DOI: 10.1055/s-2000-9603
© Georg Thieme Verlag Stuttgart · New York
Panax vietnamensis Protects Mice Against Carbon Tetrachloride-Induced Hepatotoxicity without any Modification of CYP2E1 Gene Expression
Prof. Bruno Lacarelle
Laboratory of Toxicology (EA2194)
School of Pharmacy
Univ. Méditerranée
27 Bd. Jean Moulin
13385 Marseilles Cedex 5
France
Email: bruno.lacarelle@pharmacie.univ-mrs.fr
Phone: Phone and Fax: (33) 491835608
Publication History
December 28, 1999
May 27, 2000
Publication Date:
31 December 2000 (online)
Abstract
In order to explore the effect of Panax vietnamensis on carbon tetrachloride-induced hepatotoxicity, mice were pretreated for 7 days with either crude extract or total saponins. Crude extract and total saponins dramatically decreased carbon tetrachloride-induced increase of serum GSTα level (- 50.0 %, - 49.5 % respectively). Serum AST level was significantly decreased only with total saponins (- 52.2 %) and ALT level was slightly modified. In vitro experiments shown that both preparations at high concentrations (> 2000 μg/ml) are able to inhibit CYP2E1 enzymatic activity in mouse and human microsomes. However, we did not observe any modification of Cyp2e1 gene expression (enzymatic activity, protein and mRNA levels) in mice treated with either crude extract or total saponins. Taken together, these data demonstrated that Panax vietnamensis could be used as an hepatoprotectant. However, the mechanism of action is not associated with CYP2E1 expression, as previously suggested in vitro in rat for total saponins from Panax ginseng.
Key words
Panax vietnamensis - Araliaceae - hepatoprotection - carbon tetrachloride - CYP2E1 - mice
Introduction
Ginseng (Panax ginseng C.A. Meyer) has been used for thousands of years in traditional oriental medicines. Ginseng extract or saponins have been reported to have protective effects against many toxicant-induced hepatotoxicities in experimental animals and humans. Through in vitro and in vivo studies, it has been demonstrated that Panax ginseng, P. notoginseng (Burkill) F. H. Chen, and P. japonicus C.A. Meyer root saponins exhibit protective effects against carbon tetrachloride-induced hepatotoxicity [1], [2], [3], [4]. This activity has been associated with the inhibition of cytochromes P450 (CYP), mainly CYP2E1 which is the major isoform involved in carbon tetrachloride bioactivation [5], [6], [7].
In 1973, a Panax species, Panax vietnamensis Ha et Grush, was discovered in Central Vietnam. It has been used as a “secret medicinal plant” of the Sedang ethnic minority in Vietnam for the treatment of serious illness and as a potent panacea in traditional medicine. This Panax species differs from the others by the presence of ocotillol saponins that account for over of 50 % of total saponins, notably majonoside R2 [8]. However, its pharmacological activities remain poorly understood, notably its putative hepatic protective effect.
The aim of this work was to study the effects of both crude extract and total saponins from P. vietnamensis against carbon tetrachloride-induced hepatotoxicity. In order to explain the mechanisms involved in possible hepatoprotection, their effects, in vitro and in vivo, on CYP2E1 expression were also explored.
#Materials and Methods
#Materials
The underground parts of P. vietnamensis used in the present study were collected in Gialai-Kontum province, Vietnam. The voucher specimen, SVN-M N°0998 was deposited in Scientific Research Laboratory, Faculty of Pharmacy, University of Medicine and Pharmacy of Ho Chi Minh City, Vietnam.
Crude extract and total saponins from Panax vietnamensis were obtained according to the method described by Duc et al. [9] and used as aqueous solutions. In crude extract and total saponin preparations, saponin yield was 17.2 % and 39.1 %, respectively, the composition is given in Table [1]. Corn oil, NADPH, p-nitrophenol, 4-nitrocatechol acid were obtained from Sigma Chemical Corporation (St. Quentin Fallavier, France). The other reagents were of the best quality commercially available.
| Rb1 | Rb2 | Rd | Re | Rg1 | NR1 | MR2 | |
| Crude extract | 1.71 | 0.17 | 1.57 | 0.71 | 4.18 | 0.64 | 8.27 |
| Total saponins | 3.70 | 0.35 | 3.70 | 0.72 | 7.38 | 0.65 | 22.7 |
| Rb1, Rb2, Rd, Re, and Rg1 were ginsenosides [9]. NR1 and MR2 were notoginsenoside-R1 and majonoside-R2 [9]. | |||||||
Animals
Male NMRI mice, weighing 18 - 20 g, were obtained from IFFA CREDO (France). Each animal was conditioned daily by gentle handling for 7 days prior to the experiments. For the study of the hepatoprotective effect against carbon tetrachloride-induced hepatotoxicity, the animals were divided into three groups of ten animals. Group 1 received 10 μl of water/g by gavage. Groups 2 and 3 were treated daily by gavage for 7 days with crude extract (300 μg/10 μl of water/g) and total saponins (200 μg/10 μl of water/g) respectively. On the last day of treatment, each group was divided into two subgroups treated with carbon tetrachloride (800 μl/kg, diluted in 200 μl corn oil) or with vehicle (200 μl corn oil) [7]. For the study of the effect of Cyp2e1 expression, the mice were divided into seven groups of five animals treated for 7 days. Group A received 10 μl of water/g by gavage. Groups B, C, and D were treated by gavage with crude extract at 50, 150, and 300 μg/10 μl of water/g respectively. Groups E, F, and G were treated by gavage with total saponins at 50, 100, and 200 μg/10 μl of water/g respectively.
#Human liver
Healthy human liver was obtained under strict ethical conditions after surgical resection.
#Preparation of microsomal fraction
For each liver, microsome preparation was performed by differential ultracentrifugation as previously described [10].
#Serum AST and ALT assay
Serum AST and ALT were determined in mice 24 h following carbon tetrachloride treatment with or without 7 days of pretreatment with either crude extract or total saponins (Automatic Analyzer 717, Hitachi, Japan).
#Serum GSTα assay
In mice 24 h following carbon tetrachloride treatment with or without 7 days of pretreatment with either crude extract or total saponins, serum GSTα content was determined using HEPKITTM Alpha (Biotrin, Dublin, Ireland).
#In vitro effect of crude extract and total saponins on CYP2E1 enzymatic activity in mice and human hepatic microsomes
Various amounts of either crude extract (25 - 5000 μg/ml) or total saponins (25 - 3000 μg/ml) were used to inhibit p-nitrophenol hydroxylase activity in mice and human hepatic microsomes. This activity was evaluated in triplicate, as previously described [11].
#In vivo effect of crude extract and total saponins on CYP2E1 expression
CYP2E1 expression was determined in mice treated for 7 days with water (group A), crude extract (B - D groups), or total saponins (E - G groups).
CYP2E1 catalytic activity was evaluated in triplicate using 4-nitrophenol hydroxylase activity [11].
CYP2E1 protein level was evaluated by Western blot analysis [12]. Microsomal proteins were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis using a 12 % separating gel. Samples contained 5 μg of hepatic microsomal proteins per well. The antibody from rabbit was antirat CYP2E1 (ECL Western blotting kits, Amersham, Les Ulis, France). Detection was performed using a chemoluminescence system. Light was captured on a film and the corresponding protein level was estimated by densitometry. Western blot analyses were performed in triplicate.
CYP2E1 mRNA level was evaluated by RT-PCR analysis. Total cellular RNA was isolated from liver using RNAXEL® kit (Eurobio, Les Ulis, France). 1 μg of total RNA was reverse-transcribed in 30 μl using the GibcoBRL M-MLV reverse-transcriptase (Life Technologies, Cergy Pontoise, France) in its own buffer and random primers at 37 °C for 1 h. The cDNA product (20 ng) was amplified in 25 μl using 200 μM of each of the four desoxyribonucleoside triphosphates, 250 ng of each primer (Table [2]) and 0.3 unit of Taq polymerase in its own buffer (EUROBIOTAQII® ADN polymerase, EUROBIO, Les Ulis, France). PCR was performed using the GeneAmp® PCR System 2400 (Perkin Elmer, Branchburg, U.S.A.) and carried out as follows:
-
Cyp2e1: 5 min at 93 °C, 1 min at 48 °C, 1 min at 72 °C, and 30 fold 1 min at 91 °C, 1 min at 48 °C, 1 min at 72 °C.
-
GADPH: 5 min at 93 °, 1 min at 48 °C, 1 min at 72 °C, and 24 fold 1 min at 91 °C, 1 min at 48 °C, 1 min at 72 °C.
The specificity of primers has been already studied in our group [12]. After amplification, the PCR reaction product was electrophorized on 2 % agarose gel. The gel was then stained with ethidium bromide and the image was digitalized using the Appligene Imager (Appligene-Oncor, Illkirch, France). Negative controls consisted of omitting the reverse-transcription reaction or the cDNA product (data not shown). The yield of cytochrome P450 isoforms was normalized to glyceraldehyde phospho-dehydrogenase (GAPDH) after quantitative estimation using NIH Image software (NIH, Bethesda, U.S.A.). PCR analyses were performed in triplicate.
| Primer | cDNA | Sequence | Genebank |
| name | location | (5′ - 3′) | locus no |
| Cyp2e1-S | 8-27 | GCGGTTCTTGGCATCACCGT | MUSP450E |
| Cyp2e1-AS | 536-517 | GCAGGGTGCACAGCCAATCA | MUSP450E |
| GAPDH-S | 61-80 | TGTGAACGGATTTGGCCGTA | MUSGAPDH |
| GAPDH-AS | 280-261 | TCGCTCCTGGAAGATGGTGA | MUSGAPDH |
| -S and -AS were Sens and AntiSens respectively. | |||
Statistical analysis
Statistical differences between groups were assessed by the Anova test, and the Scheffe test was used for group-by-group comparisons. Statistical significance was set at P < 0.05.
#Results
#Effects of crude extract and total saponins against carbon tetrachloride-induced hepatotoxicity
In order to assess tetrachloride-induced hepatotoxicity in control and treated groups, we measured ALT (Fig. [1]), AST (Fig. [2]), and GSTα (Fig. [3]) serum levels which are markers of this intoxication. In mouse control groups treated with either vehicle (water), crude extract (300 μg/10 μl of water/g), or total saponins (200 μg/10 μl of water/g), we did not observe any difference. As expected, ALT, AST, and GSTα serum levels were dramatically increased in the carbon tetrachloride-treated group (138-, 111-, and 3.2-fold, respectively). The carbon tetrachloride-induced increase of plasma ALT levels was only slightly reduced by pretreatment by crude extract or total saponins. Plasma AST levels were more markedly reduced (- 24.5 %, - 52.2 % respectively), with a significant decrease after pretreatment with total saponins (P < 0.05). Plasma GSTα levels were significantly reduced (- 50.0 % and - 49.5 %, respectively, P < 0.05) in the two treated groups, with a comparable effect of both crude extract and total saponins. These results suggest that Panax vietnamensis roots are able to prevent at least in part carbon tetrachloride-induced hepatotoxicity, as previously described with Panax ginseng, Panax notoginseng, and Panax japonicus roots [1], [2], [3], [4].
Fig. 1Effect of either crude extract or total saponins from Panax vietnamensis on serum ALT level in mice intoxicated or not by carbon tetrachloride. Results are expressed as mean ± SEM (n = 5). C: control group. E: group pretreated with crude extract (300 μg/10 μl of water/g, for 7 days) and with vehicle. S: treated with total saponins (200 μg/10 μl of water/g, for 7 days) and with vehicle. CCl4: group treated with carbon tetrachloride (800 μl/kg the last day). CCl4 + E: group pretreated with crude extract (300 μg/10 μl of water/g, for 7 days) and treated with carbon tetrachloride (800 μl/kg the last day). CCl4 + S: group pretreated with total saponins (200 μg/10 μl of water/g, for 7 days) and treated with carbon tetrachloride (800 μl/kg the last day).
Fig. 2Effect of either crude extract or total saponins from Panax vietnamensis on serum AST level in mice intoxicated or not by carbon tetrachloride. Results are expressed as mean ± SEM (n = 5). C: control group, E: group pretreated with crude extract (300 μg/10 μl of water/g, for 7 days) and with vehicle. S: treated with total saponins (200 μg/10 μl of water/g, for 7 days) and with vehicle. CCl4: group treated with carbon tetrachloride (800 μl/kg the last day). CCl4 + E: group pretreated with crude extract (300 μg/10 μl of water/g, for 7 days) and treated with carbon tetrachloride (800 μl/kg the last day). CCl4 + S: group pretreated with total saponins (200 μg/10 μl of water/g, for 7 days) and treated with carbon tetrachloride (800 μl/kg the last day). *: P < 0.05.
Fig. 3Effect of either crude extract or total saponins from Panax vietnamensis on serum GSTα level in mice intoxicated or not by carbon tetrachloride. Results are expressed as mean ± SEM (n = 5). C: control group. E: group pretreated with crude extract (300 μg/10 μl of water/g, for 7 days) and with vehicle. S: treated with total saponins (200 μg/10 μl of water/g, for 7 days) and with vehicle. CCl4: group treated with carbon tetrachloride (800 μl/kg the last day). CCl4 + E: group pretreated with crude extract (300 μg/10 μl of water/g, for 7 days) and treated with carbon tetrachloride (800 μl/kg the last day). CCl4 + S: group pretreated with total saponins (200 μg/10 μl of water/g, for 7 days) and treated with carbon tetrachloride (800 μl/kg the last day). *: P < 0.05.
In vitro effect of crude extract and total saponins on CYP2E1 enzymatic activity in mice and human hepatic microsomes
Crude extract (Fig. [4]) inhibited in vitro p-nitrophenol hydroxylase activity in mice and human hepatic microsomes. In mice, crude extract at 4000 μg/ml disrupted CYP2E1 catalytic activity, while in humans the activity was reduced by 87.2 % at the highest concentration (5000 μg/ml). At the lowest concentrations (50 and 100 μg/ml) we observed in both species a slight increase of p-nitrophenol hydroxylase activity.
Total saponins (Fig. [5]) also inhibited in vitro p-nitrophenol hydroxylase activity in mice and human hepatic microsomes (- 89.4 % and - 96.0 %, at 3000 μg/ml). Their effects were slightly more marked in humans than in mice, and total saponins appeared to be a little more active than crude extract in both species. A slight increase of p-nitrophenol activity was also observed in human liver microsomes with the lowest doses of total saponins.
Taken together, these results demonstrate a potent in vitro inhibitory effect toward CYP2E1 enzymatic activity of either crude extract or total saponins.
Fig. 4 In vitro inhibitory effect of crude extract from Panax vietnamensis on p-nitrophenol hydroxylase activity in mouse (A) and human (B) hepatic microsomes.
Fig. 5 In vitro inhibitory effect of total saponins from Panax vietnamensis on p-nitrophenol hydroxylase activity in mouse (A) and human (B) hepatic microsomes.
In vivo effect of crude extract and total saponins on CYP2E1 expression in mice
In order to explore the in vivo effect of Panax vietnamensis roots on CYP2E1 expression (Fig. [6]), mice were treated for 7 days with low, medium and high concentrations of either crude extract or total saponins. p-Nitrophenol hydroxylase activity paralleled CYP2E1 protein level and CYP2E1 mRNA level. However, we did not find any significant difference between the control group (group A) and the treated groups (B-G groups).
Taken together, these results suggest that in vivo treatments with either crude extract or total saponins are not able to modify CYP2E1 expression at the doses used.
Fig. 6 In vivo effect of either crude extract, or total saponins from Panax vietnamensis on p-nitrophenol hydroxylase activity (A), CYP2E1 protein level (B), and CYP2E1 mRNA level (C). Result are expressed as mean ± SEM (n = 5). A: control group. B: group treated with crude extract at 50 μg/10 μl of water/g. C: group treated with crude extract at 150 μg/10 μl of water/g. D: group treated with crude extract at 300 μg/10 μl of water/g. E: group treated with total saponins at 50 μg/10 μl of water/g. F: group treated with total saponins at 100 μg/10 μl of water/g. G: group treated with total saponins at 200 μg/10 μl of water/g. REL: relative expression level.
Discussion
Previous studies have demonstrated that Panax ginseng, P. notoginseng, and P. japonicus root prevents in part carbon tetrachloride-induced hepatotoxicity in rats [1], [2], [3], [4]. Through in vitro inhibition studies, this hepatoprotective effect has been associated mainly to the inhibition of CYP2E1 catalytic activity [5]. The aim of the present study was to explore on one hand the hepatoprotective effect of a new Panax species, P. vietnamensis, toward carbon tetrachloride acute intoxication, and on the other hand its in vitro and in vivo effect on CYP2E1 activity and CYP2E1 expression respectively.
Our results demonstrate that in vivo treatments with high dose of either crude extract or total saponins do not modify ALT, AST, or GSTα serum levels. The administration of carbon tetrachloride led to an acute hepatitis associated with an increase of ALT, AST and GSTα serum levels [7], [13], and as previously described, we did not observe any modification of lipid peroxidation (data not shown) [14]. Our results demonstrate that pretreatments with high dose of either crude extract or total saponins reduce carbon tetrachloride-induced hepatotoxicity, with a more marked effect of the latter. Carbon tetrachloride is mainly bioactivated by CYP2E1 in mammalian species [6], [7]. We therefore explored the in vitro and in vivo effects of P. vietnamensis preparations on CYP2E1 catalytic activity and expression, respectively.
As previously described for Panax ginseng [5], crude extract and total saponins from P. vietnamensis inhibited, at high doses (> 200 μg/ml), CYP2E1 catalytic activities in mouse and human liver microsomes. Total saponins seemed to be more active than crude extract, notably in humans. These results appeared to be in good agreement with the in vivo hepatoprotective effect against carbon tetrachloride-induced toxicity. At the lowest doses (50 and 100 μg/ml) of crude extract and total saponins, we observed a slight increase in p-nitrophenol activity in mouse and human hepatic microsomes and in human hepatic microsomes respectively. This phenomenon was probably due to a slight permeabilization of the phospholipid layer increasing the accessibility of the catalytic site.
P. vietnamensis crude extract or total saponins inhibited in both species CYP2E1 catalytic activity at very high concentrations, as compared with substrate concentration (p-nitrophenol, 200 μM), and an aspecific inhibition of this isoform cannot be ruled out. We therefore have treated the mice with various doses of either crude extract or total saponins and explored CYP2E1 expressions. CYP2E1 catalytic activity, protein level and mRNA level remained unchanged. These data demonstrate that the observed hepatoprotective effect against carbon tetrachloride-induced toxicity is not associated with a modulation of the expression of the major CYP involved in its bioactivation. An involvement of GST would appear to be unlikely since the GSTα subfamily is not modified by P. vietnamensis pretreatments. This phenomenon could be associated at least in part with an inhibitory action on free radical-mediated lipid peroxidation, attributable to minor components rather than the main saponin components (majonoside-R2, ginsenoside-Rg1 and ginsenoside-Rb1) [15].
In conclusion, we have demonstrated in mice that P. vietnamensis can protect, at least in part, carbon tetrachloride-induced hepatotoxicity, as previously described for P. ginseng, P. notoginseng, and P. japonicus. Total saponins appeared to be more active than crude extract. In vivo, this protective effect was not associated with CYP2E1 gene expression, while we observed in vitro an inhibition of the CYP2E1 enzymatic activity in mouse and human hepatic microsomes. Taken together, these data suggest that P. vietnamensis could be used as a potent hepatoprotectant, even if the mechanism of action remains to be understood.
#References
- 1 Hikino H, Kiso Y, Kinouchi J, Sanada S, Shoji J. Antihepatotoxic actions of ginsenosides from Panax ginseng roots. Planta Medica. 1985; 57 62-4
- 2 Jeong T C, Kim H J, Park J I, Ha C S, Park J D, Kim S I, Roh J K. Protective effects of red ginseng saponins against carbon tetrachloride-induced hepatotoxicity in Sprague Dawley rats. Planta Medica. 1997; 63 136-40
- 3 Liu J, Liu Y, Klaassen C D. The effect of Chinese hepatoprotective medicines on experimental liver injury in mice. Journal of Ethnopharmacology. 1994; 42 183-91
- 4 Song J C, Liu J, Zhang Y, Zhan Q Z, Zhou J, Wu M Z. Effect of total saponins of Panax notoginseng on DNA and protein metabolism in CCl4 intoxicated mice. Bulletin of Pharmacy Sinica. 1982; 17 67-9
- 5 Kim H J, Chun Y J, Park J D, Kim S I, Roh J K, Jeong T C. Protection of rat liver microsomes against carbon tetrachloride-induced lipid peroxidation by red ginseng saponin through cytochrome P450 inhibition. Planta Medica. 1997; 63 415-8
- 6 Johansson I, Ingelman-Sundberg M. Carbon tetrachloride-induced lipid peroxidation dependent on an ethanol-inducible form of rabbit liver microsomal cytochrome P-450. FEBS Letters. 1985; 183 265-9
- 7 Wong F W, Chan W Y, Lee S S. Resistance to carbon tetrachloride-induced hepatotoxicity in mice which lack CYP2E1 expression. Toxicology and Applied Pharmacology. 1998; 153 109-18
- 8 Duc N M, Kasai R, Ohtani K, Ito A, Yamasaki K, Nham T N, Tanaka O. New saponins from Vietnamese ginseng: highlights on biogenesis of dammarane triterpenoids. Advanced in Experimental Medecine Biology. 1996; 404 129-49
- 9 Duc N M, Nham N T, Kasai R, Ito A, Yamasaki K, Tanaka O. Saponins from Vietnamese ginseng, Panax vietnamensis Ha et Grushv. collected in central Veitnam. Chemical and Pharmaceutical Bulletin. 1993; 41 2010-4
- 10 van der Hoeven T A, Coon M J. Preparation and properties of partially purified cytochrome P-450 and reduced nicotinamide adenine dinucleotide phosphate-cytochrome P-450 reductase from rabbit liver microsomes. Journal of Biological Chemistry. 1974; 249 6302-10
- 11 Koop D R, Laethem C L, Tierney D J. The utility of p-nitrophenol hydroxylation in P450IIE1 analysis. Drug Metabolism Reviews. 1989; 20 541-51
- 12 Villard P H, Seree E M, Re J L, De Meo M, Barra Y, Attolini L, Dumenil G, Catalin J, Durand A, Lacarelle B. Effects of tobacco smoke on the gene expression of the Cyp1a, Cyp2b, Cyp2e, and Cyp3a subfamilies in mouse liver and lung: relation to single strand breaks of DNA. Toxicology and Applied Pharmacology. 1998; 148 195-204
- 13 Clarke H, Egan D A, Heffernan M, Doyle S, Byrne C, Kilty C, Ryan M P. Alpha-glutathione s-transferase (alpha-GST) release, an early indicator of carbon tetrachloride hepatotoxicity in the rat. Human and Experimental Toxicology. 1997; 16 154-7
- 14 Diaz Gomez M I, de Castro C R, D'Acosta N, de Fenos O M, de Ferreyra E C, Castro J A. Species differences in carbon tetrachloride-induced hepatotoxicity: the role of CCl4 activation and of lipid peroxidation. Toxicology and Applied Pharmacology. 1975; 34 102-14
- 15 Huong N T, Matsumoto K, Kasai R, Yamasaki K, Watanabe H. In vitro antioxidant activity of Vietnamese ginseng saponin and its components. Biological and Pharmaceutical Bulletin. 1998; 21 978-81
Prof. Bruno Lacarelle
Laboratory of Toxicology (EA2194)
School of Pharmacy
Univ. Méditerranée
27 Bd. Jean Moulin
13385 Marseilles Cedex 5
France
Email: bruno.lacarelle@pharmacie.univ-mrs.fr
Phone: Phone and Fax: (33) 491835608
References
- 1 Hikino H, Kiso Y, Kinouchi J, Sanada S, Shoji J. Antihepatotoxic actions of ginsenosides from Panax ginseng roots. Planta Medica. 1985; 57 62-4
- 2 Jeong T C, Kim H J, Park J I, Ha C S, Park J D, Kim S I, Roh J K. Protective effects of red ginseng saponins against carbon tetrachloride-induced hepatotoxicity in Sprague Dawley rats. Planta Medica. 1997; 63 136-40
- 3 Liu J, Liu Y, Klaassen C D. The effect of Chinese hepatoprotective medicines on experimental liver injury in mice. Journal of Ethnopharmacology. 1994; 42 183-91
- 4 Song J C, Liu J, Zhang Y, Zhan Q Z, Zhou J, Wu M Z. Effect of total saponins of Panax notoginseng on DNA and protein metabolism in CCl4 intoxicated mice. Bulletin of Pharmacy Sinica. 1982; 17 67-9
- 5 Kim H J, Chun Y J, Park J D, Kim S I, Roh J K, Jeong T C. Protection of rat liver microsomes against carbon tetrachloride-induced lipid peroxidation by red ginseng saponin through cytochrome P450 inhibition. Planta Medica. 1997; 63 415-8
- 6 Johansson I, Ingelman-Sundberg M. Carbon tetrachloride-induced lipid peroxidation dependent on an ethanol-inducible form of rabbit liver microsomal cytochrome P-450. FEBS Letters. 1985; 183 265-9
- 7 Wong F W, Chan W Y, Lee S S. Resistance to carbon tetrachloride-induced hepatotoxicity in mice which lack CYP2E1 expression. Toxicology and Applied Pharmacology. 1998; 153 109-18
- 8 Duc N M, Kasai R, Ohtani K, Ito A, Yamasaki K, Nham T N, Tanaka O. New saponins from Vietnamese ginseng: highlights on biogenesis of dammarane triterpenoids. Advanced in Experimental Medecine Biology. 1996; 404 129-49
- 9 Duc N M, Nham N T, Kasai R, Ito A, Yamasaki K, Tanaka O. Saponins from Vietnamese ginseng, Panax vietnamensis Ha et Grushv. collected in central Veitnam. Chemical and Pharmaceutical Bulletin. 1993; 41 2010-4
- 10 van der Hoeven T A, Coon M J. Preparation and properties of partially purified cytochrome P-450 and reduced nicotinamide adenine dinucleotide phosphate-cytochrome P-450 reductase from rabbit liver microsomes. Journal of Biological Chemistry. 1974; 249 6302-10
- 11 Koop D R, Laethem C L, Tierney D J. The utility of p-nitrophenol hydroxylation in P450IIE1 analysis. Drug Metabolism Reviews. 1989; 20 541-51
- 12 Villard P H, Seree E M, Re J L, De Meo M, Barra Y, Attolini L, Dumenil G, Catalin J, Durand A, Lacarelle B. Effects of tobacco smoke on the gene expression of the Cyp1a, Cyp2b, Cyp2e, and Cyp3a subfamilies in mouse liver and lung: relation to single strand breaks of DNA. Toxicology and Applied Pharmacology. 1998; 148 195-204
- 13 Clarke H, Egan D A, Heffernan M, Doyle S, Byrne C, Kilty C, Ryan M P. Alpha-glutathione s-transferase (alpha-GST) release, an early indicator of carbon tetrachloride hepatotoxicity in the rat. Human and Experimental Toxicology. 1997; 16 154-7
- 14 Diaz Gomez M I, de Castro C R, D'Acosta N, de Fenos O M, de Ferreyra E C, Castro J A. Species differences in carbon tetrachloride-induced hepatotoxicity: the role of CCl4 activation and of lipid peroxidation. Toxicology and Applied Pharmacology. 1975; 34 102-14
- 15 Huong N T, Matsumoto K, Kasai R, Yamasaki K, Watanabe H. In vitro antioxidant activity of Vietnamese ginseng saponin and its components. Biological and Pharmaceutical Bulletin. 1998; 21 978-81
Prof. Bruno Lacarelle
Laboratory of Toxicology (EA2194)
School of Pharmacy
Univ. Méditerranée
27 Bd. Jean Moulin
13385 Marseilles Cedex 5
France
Email: bruno.lacarelle@pharmacie.univ-mrs.fr
Phone: Phone and Fax: (33) 491835608
Fig. 1Effect of either crude extract or total saponins from Panax vietnamensis on serum ALT level in mice intoxicated or not by carbon tetrachloride. Results are expressed as mean ± SEM (n = 5). C: control group. E: group pretreated with crude extract (300 μg/10 μl of water/g, for 7 days) and with vehicle. S: treated with total saponins (200 μg/10 μl of water/g, for 7 days) and with vehicle. CCl4: group treated with carbon tetrachloride (800 μl/kg the last day). CCl4 + E: group pretreated with crude extract (300 μg/10 μl of water/g, for 7 days) and treated with carbon tetrachloride (800 μl/kg the last day). CCl4 + S: group pretreated with total saponins (200 μg/10 μl of water/g, for 7 days) and treated with carbon tetrachloride (800 μl/kg the last day).
Fig. 2Effect of either crude extract or total saponins from Panax vietnamensis on serum AST level in mice intoxicated or not by carbon tetrachloride. Results are expressed as mean ± SEM (n = 5). C: control group, E: group pretreated with crude extract (300 μg/10 μl of water/g, for 7 days) and with vehicle. S: treated with total saponins (200 μg/10 μl of water/g, for 7 days) and with vehicle. CCl4: group treated with carbon tetrachloride (800 μl/kg the last day). CCl4 + E: group pretreated with crude extract (300 μg/10 μl of water/g, for 7 days) and treated with carbon tetrachloride (800 μl/kg the last day). CCl4 + S: group pretreated with total saponins (200 μg/10 μl of water/g, for 7 days) and treated with carbon tetrachloride (800 μl/kg the last day). *: P < 0.05.
Fig. 3Effect of either crude extract or total saponins from Panax vietnamensis on serum GSTα level in mice intoxicated or not by carbon tetrachloride. Results are expressed as mean ± SEM (n = 5). C: control group. E: group pretreated with crude extract (300 μg/10 μl of water/g, for 7 days) and with vehicle. S: treated with total saponins (200 μg/10 μl of water/g, for 7 days) and with vehicle. CCl4: group treated with carbon tetrachloride (800 μl/kg the last day). CCl4 + E: group pretreated with crude extract (300 μg/10 μl of water/g, for 7 days) and treated with carbon tetrachloride (800 μl/kg the last day). CCl4 + S: group pretreated with total saponins (200 μg/10 μl of water/g, for 7 days) and treated with carbon tetrachloride (800 μl/kg the last day). *: P < 0.05.
Fig. 4 In vitro inhibitory effect of crude extract from Panax vietnamensis on p-nitrophenol hydroxylase activity in mouse (A) and human (B) hepatic microsomes.
Fig. 5 In vitro inhibitory effect of total saponins from Panax vietnamensis on p-nitrophenol hydroxylase activity in mouse (A) and human (B) hepatic microsomes.
Fig. 6 In vivo effect of either crude extract, or total saponins from Panax vietnamensis on p-nitrophenol hydroxylase activity (A), CYP2E1 protein level (B), and CYP2E1 mRNA level (C). Result are expressed as mean ± SEM (n = 5). A: control group. B: group treated with crude extract at 50 μg/10 μl of water/g. C: group treated with crude extract at 150 μg/10 μl of water/g. D: group treated with crude extract at 300 μg/10 μl of water/g. E: group treated with total saponins at 50 μg/10 μl of water/g. F: group treated with total saponins at 100 μg/10 μl of water/g. G: group treated with total saponins at 200 μg/10 μl of water/g. REL: relative expression level.