Pharmacological Potential of cis-jasmone in Adult Zebrafish (Danio rerio)

• Abstract
• Introduction
• Results
• Discussion
• Materials and Methods
• Drugs and reagents
• Zebrafish
• General protocol
• Evaluation of acute toxicity of cis-jasmone at the tested concentrations
• Evaluation of the effect of cis-jasmone on the locomotor activity of adult zebrafish
• Evaluation of cis-jasmone anticonvulsant activity
• Assessment of cis-jasmone anxiolytic-like activity
• Assessment of the anti-inflammatory activity of cis-jasmone
• Evaluation of cis-jasmone orofacial antinociceptive activity
• Cinnamaldehyde-induced orofacial nociception
• Capsaicin-induced orofacial nociception
• Glutamate-induced orofacial nociception
• Menthol-induced orofacial nociception
• Acidic saline-induced orofacial nociception
• Evaluation of the involvement of central afferent fibers sensitive to cinnamaldehyde
• Evaluation of the involvement of central afferent fibers sensitive to capsaicin
• Evaluation of the effect of cis-jasmone relative gene expression of TRPA1 and TRPV1 in the brain of the adult zebrafish
• Molecular docking study between cis-jasmone and TRPV1, TRPA1, and GABAA receptors
• Statistical analysis
• Contributorsʼ Statement
• References

Abstract

This study evaluates the pharmacological potential of cis-jasmone (CJ) in adult zebrafish (Danio rerio; aZF). Initially, aZF (n = 6/group) were pretreated (20 µL; p. o.) with CJ (0.1 or 0.3 or 1.0 mg/mL) or vehicle (0.5% Tween 80). The animals were submitted to acute toxicity and locomotion tests, pentylenetetrazole-induced seizure, carrageenan-induced abdominal edema, and cinnamaldehyde-, capsaicin-, menthol-, glutamate-, and acid saline-induced orofacial nociception. The possible mechanisms of anticonvulsant, anxiolytic, and antinociceptive action were evaluated. The involvement of central afferent fibers sensitive to cinnamaldehyde and capsaicin and the effect of CJ on the relative gene expression of TRPA1 and TRPV1 in the brain of aZF were also analyzed, in addition to the study of molecular docking between CJ and TRPA1, TRPV1 channels, and GABA_A receptors. CJ did not alter the locomotor behavior and showed pharmacological potential in all tested models with no toxicity. The anticonvulsant effect of CJ was prevented by flumazenil (GABAergic antagonist). The anxiolytic-like effect of CJ was prevented by flumazenil and serotonergic antagonists. The antinociceptive effect was prevented by TRPA1 and TRPV1 antagonists. Chemical ablation with capsaicin and cinnamaldehyde prevented the orofacial antinociceptive effect of CJ. Molecular docking studies indicate that CJ interacted with TRPA1, TRPV1, and GABA_A receptors. CJ inhibited the relative gene expression of TRPA1 and TRPV1. CJ has pharmacological potential for the treatment of seizures, anxiety, inflammation, and acute orofacial nociception. These effects are obtained by modulating the GABAergic and serotonergic systems, as well as the TRPs and ASIC channels.

Introduction

Jasmine essential oils have been shown to have spasmolytic action through an increase in intracellular cAMP, with the possibility of calcium-channel blockade [1] and reduction in labor pain severity and outcome in nulliparous women [2]. One of the main constituents of the jasmine flower essential oil is cis-jasmone, which is present in several Jasminum species [3], with jasmonates being known to have an antinociceptive effect [4].

Cis-jasmone represents 2 – 3% of the jasmine essential oil [5], being also found in the essential oil of narcissus, orange blossom, various species of mint, bergamot, tenacious, kiwi, honeysuckle, magnolia, lotus root, and tobacco [6]. Cis-jasmone increases the production of secondary metabolites in plants, protecting them against pests, and this compound is considered an endogenous plant regulator that acts on the plantʼs defense mechanism and other physiological processes, in addition to representing an important contribution to the creation of perfume and cosmetics [6], [7], [8].

Regarding its pharmacological potential, cis-jasmone has a sedative effect [9], and it has also been shown to be effective for the treatment of chronic ulcerative rectocolitis because of its intestinal anti-neuroinflammatory capacity by acting on the enteric nervous system and because of its tissue repair capacity [10].

Zebrafish (Danio rerio), a member of the Cyprinidae family, has a fully sequenced genome and shares 71% of the genetic orthology and body plan similarity with humans [11]. Data previously reported in the literature indicate the use of zebrafish in nociception [12], [13], orofacial nociception [14], [15], [16], inflammation [17], and anxiety models [18], [19].

Due to the scarcity of pharmacological studies with cis-jasmone in the literature, this study aims to evaluate the pharmacological potential of cis-jasmone in adult zebrafish.

Results

The oral administration of CJ did not change the behavior of the animals and did not promote animal death during the 48 h of analysis (data not shown). CJ did not alter the locomotor activity of adult zebrafish in the open field test at the tested concentrations ([Fig. 1]).

The animals pretreated with CJ (0.1 and 0.3 mg/mL) showed a longer latency for the onset of the seizure chemically induced by pentylenetetrazole ([Fig. 2 a]–c). The higher concentration (1.0 mg/mL) did not prevent the seizures. The anticonvulsant effect of CJ (0.1 mg/mL) in the three stages of the test was completely abolished by pretreatment with flumazenil, as shown in [Fig. 2 d] – f.

Animals treated with CJ showed longer permanence in the light zone ([Fig. 3 a]) and this effect was prevented by flumazenil ([Fig. 3 b]) and by the serotonergic antagonists pizotifen (5-HT_1A and 5-HT_2A/2C) and granisetron (5-HT₃); however, this effect was resistant to pretreatment with cyproheptadine (Fig [4 a]–c).

CJ also showed a systemic anti-inflammatory effect ([Fig. 5]).

CJ reduced the orofacial nociceptive behavior induced by cinnamaldehyde ([Fig. 6 a]) and this effect was prevented by the pretreatment with HC-030031 ([Fig. 6 b]). All tested CJ concentrations reduced the orofacial nociceptive effect induced by capsaicin ([Fig. 7 a]), and this effect was prevented by pretreatment with capsazepine ([Fig. 7 b]). CJ inhibited the orofacial nociception induced by menthol ([Fig. 8]), glutamate ([Fig. 9]), and acid saline ([Fig. 10]). Chemical ablation with cinnamaldehyde also prevented the orofacial antinociceptive effect of CJ ([Fig. 11]). However, chemical ablation with capsaicin did not prevent the orofacial antinociceptive effect of CJ on glutamate-induced nociception ([Fig. 12]).

CJ inhibited TRPA1 and TRPV1 expression in the adult zebrafish brain ([Fig. 13 a] and [b]).

Molecular docking studies indicate that CJ interacted with TRPA1, TRPV1, and GABA_A receptors. TRPA1 and cis-jasmone in the most energetic group; the recruitment of seven amino acid residues (Ile95, Asn699, Lys969, Ser972, Ile1033, Pro1034, and Asp1037) is observed, and six hydrogen bonds that range from 2.6 to 3.1 angstroms, which suggests strong anchoring of the ligand ([Fig. 14 a]). With TRPV1 and cis-jasmone, in the most energetic group, the recruitment of six amino acid residues (Ala680a, Gly683a, Ala680b, Ile679b, Gly683c, and Asn687c) is observed, as well as eight chemical bonds that range from 1.6 to 3.8 angstroms, which suggests strong anchoring of the ligand ([Fig. 14 b]). [Fig. 14 c] suggests that there is chemical, spatial, and energetic compatibility between the GABA_A receptor and cis-jasmone in the most energetic group; the recruitment of six amino acid residues (Ile47, Asp48, Asn54, Pro84, Lys102, and Gly182) is observed and seven chemical bonds that range from 2.6 to 3.1 angstroms, equivalent to van der Walls forces and even hydrogen bonds.

Discussion

This study indicated the anticonvulsant, anxiolytic, anti-inflammatory and orofacial antinociceptive effects of the monoterpene cis-jasmone (CJ).

Although CJ has extensive applicability as a semiochemical for use in integrated pest management, it does not harm the plant, either [20]. For this reason, the acute toxicity of CJ in adult zebrafish was initially evaluated with no evidence of harm at the tested concentrations, so the oral administration of CJ in our study did not change animal behavior, offering safety for further testing.

After that, the open field test was carried out, which allowed the assessment of whether CJ would alter the locomotor activity of the adult zebrafish. The natural behavior of zebrafish in the open field is characterized by constant swimming activity, and manifestations of immobility are rarely observed under natural conditions [21]. Therefore, locomotor activity is a behavioral parameter used to identify drugs acting on the central nervous system (CNS), which have a potential anxiolytic, sedative, or muscle relaxant effect [22]. This initial assessment is important when testing a new compound to know whether it alone interferes with the animalʼs locomotor activity, a fact that did not occur with any of the tested CJ concentrations.

Pentylenetetrazole inhibits the Cl⁻ current in GABA_A ion channels, promoting an excitatory picture, which determines one of the mechanisms responsible for causing seizures in an animal model, with treatment often being performed by using the GABA_A receptor antagonist (phenobarbital and benzodiazepines) [23]. The animals pretreated with CJ showed a longer latency until the onset of the seizure chemically induced by pentylenetetrazole. This result is in line with the clinical findings of Betts [24], who found a reduction in brain discharges in epileptic patients after an aromatherapy session with jasmine oil.

Hossain et al [25] suggested that CJ would act by enhancing the response of the GABA_A channel. To analyze whether the anticonvulsant effect of CJ would be via the GABAergic route, groups of animals were pretreated with flumazenil (GABAergic antagonist) and then submitted to the test with pentylenetetrazole. The anticonvulsant effect of CJ, in the three stages of the test, was completely abolished by pretreatment with flumazenil.

The light/dark test assesses the increase in zebrafish exploratory activity in the light area of the aquarium [18]. The increase in permanence time in the light area is an effective test to assess the anxiolytic effect of drugs [26], [27].

Animals treated with CJ showed greater permanence in the light zone, suggesting an anxiolytic-like effect of the terpene, and this effect was prevented by flumazenil, by the serotonergic antagonists pizotifen (5-HT_1A and 5-HT_2A/2C) and granisetron (5-HT₃); however, the effect was resistant to pretreatment with cyproheptadine. These results suggest that the anxiolytic-like effect provided by CJ would be mediated by the GABAergic and serotonergic systems.

CJ also had a systemic anti-inflammatory effect. The topical anti-inflammatory effect of CJ was recently demonstrated by Moura Fé [28], and the author concluded that the anti-inflammatory effect of CJ would be mainly associated with the antagonism of the TRPV1 channel. However, an action occurring via serotonergic receptors cannot be ruled out either, since serotonin contributes to vasodilation and increased vascular permeability in inflammation [29] and CJ seems to modulate the serotonergic response (as shown above).

CJ reduced the orofacial nociceptive behavior induced by cinnamaldehyde (TRPA1 agonist). To assess whether CJ was modulating the TRPA1 channel, the antagonist of the TRPA1 channel (HC-030031) was administered before CJ and the blocking of the orofacial antinociceptive effect promoted by CJ was verified. This result suggests the participation of the TRPA1 channel in the orofacial antinociceptive effect of CJ.

In this study, all tested concentrations of CJ reduced the orofacial nociceptive effect induced by capsaicin and this effect was prevented by pretreatment with the TRPV1 channel antagonist, capsazepine, indicating that CJ could also act by modulating the TRPV1 channel. As the most significant effect of the lowest concentration studied was verified in the capsaicin test, it was decided to evaluate the participation of the TRPV1 channel in the orofacial antinociceptive effect of CJ, since TRPV1 and TRPA1 are co-expressed in neurons of the dorsal root ganglion in zebrafish [30]. These findings are reinforced by the inhibition of TRPV1 gene expression by CJ. Some studies claim that these channels can interact to influence each otherʼs properties. In this sense, the recently reported heteromerization between TRP channels is suggestive of the interaction mechanism [30]. It was also found that CJ inhibited the orofacial nociception induced by menthol, glutamate, and acid saline, indicating a possible action on TRPM8, NMDA and ASIC receptors.

Ho, Ward, and Calkins [31] addressed the association between the TRPV1 and TRPA1 genotypes with a human phenotype of capsaicin-induced hyperalgesia to thermal stimuli. The results were biologically plausible and adequate to demonstrate the function of the TRPA1 and TRPV1 channels. When evaluating relative gene expression, we found that CJ inhibited TRPA1 expression in the adult zebrafish brain, providing further evidence that CJ modulates the TRPA1 channel.

Furthermore, chemical, spatial, and energetic evidence has been observed in the study of molecular docking, showing the interaction between the TRPA1 channel and CJ, supporting the possible antagonist activity observed in vivo. This relationship is also due to the physicochemical properties of the amino acid mostly recruited in the recognition of the ligand: isoleucine, which has an aliphatic and apolar side chain, extending the reach of the reactive ends of the ligands. The literature has emphasized the importance of TRPA1 in pain sensation in mammals because the differential methylation of the TRPA1 promoter is associated with differential heat pain sensitivity [32].

The molecular docking study showed chemical, spatial, and energetic compatibility between the GABA_A receptor and CJ. Thus, the formation of the GABA_A/CJ complex is evidenced in vivo and in silico, and these results suggest that CJ exerts its effect by interacting with the GABA_A channel [33]. As shown in [Fig. 14 c], there is evidence that the CJ interaction site does not obstruct the passage of Cl⁻, suggesting an agonist action, increasing Cl⁻ influx.

To verify the interaction between CJ and the TRPV1 channel, the molecular docking study was performed, which provided chemical, spatial, and energetic evidence of this interaction between CJ and the TRPV1 channel ([Fig. 14 b]), indicating the high interaction and promotion of biological activity observed in vitro and in vivo. The ligand recognition by the external residues of the TRPV1 channel was observed, allowing this ligand to migrate through the passage of ions and carry its bonds to the alpha-helix structures of the intermembrane fraction of the channel.

Although CJ interacts with both the TRPV1 and TRPA1 channels ([Fig. 14 a]), some structural nuances of the docking sites promote subtle differences in cis-jasmone affinity and stability by acting as an antagonist of TRPV1 and TRPA1 receptors. However, it is necessary to investigate whether CJ would be acting as a noncompetitive antagonist of the TRPV1 and TRPA1 channels. Despite establishing two fewer chemical bonds than in the TRPV1 channel, the greater recruitment of amino acid residues in the TRPA1 channel promotes greater stabilization of the region, reducing flexibility, which characterizes greater stabilization of the TRPA1 channel in relation to the TRPV1 channel. It is a fact that 97% of sensory neurons in mammals that express the TRPA1 receptor, co-express the TRPV1 receptor, while 30% of neurons that express the TRPV1 receptor, co-express the TRPA1 receptor [34]. Story et al. [35] state that TRPV1 and TRPA1 receptors co-expressed on primary afferent fibers work together to activate nociceptive afferent fibers during sustained isometric contraction, suggesting that TRPV1 and TRPA1 receptors are potential targets for the control of inflammatory muscle pain.

The orofacial antinociceptive effect of CJ was blocked when CJ was administered to animals undergoing a chemical ablation process with capsaicin. This finding is yet another indication that CJ seems to act as an antagonist of the TRPV1 channel. Chemical ablation with cinnamaldehyde also prevented the orofacial antinociceptive effect of CJ on capsaicin-induced orofacial nociception. However, chemical ablation with capsaicin did not prevent the orofacial antinociceptive effect of CJ on glutamate-induced orofacial nociception. Knowing that TRPA1 receptors are co-expressed with TRPV1 receptors on small-diameter afferent peptidergic fibers, and since an inhibition caused by the blocking of NMDA receptors was observed in the nociceptive response induced by cinnamaldehyde, it seems reasonable to suggest that there is an interaction between the glutamatergic receptors and TRPA1 channels peripherally located in primary afferent neurons, since the signaling through glutamate receptors and TRP channels are important mediators of craniofacial muscle pain [36]. It is known that these two pathways intersect in the trigeminal nociceptive mechanisms and that activation of the TRP channels in nociceptors can induce the release of neuropeptides and glutamate from peripheral terminals at the injection site to produce neurogenic inflammation [37].

In conclusion, cis-jasmone has pharmacological potential for the treatment of seizures, anxiety, inflammation, and acute orofacial nociception. These effects are obtained by modulating the GABAergic, glutamatergic, and serotonergic systems, as well as through the TRPs and ASIC channels. However, it is necessary to investigate whether CJ would act as a noncompetitive antagonist of the TRPV1 and TRPA1 channels.

Materials and Methods

Drugs and reagents

The following reagents and drugs were used in the study: cis-jasmone, capsaicin, capsazepine, carrageenan, cinnamaldehyde, cyproheptadine, flumazenil, granisetron, glutamate, HC-030031, menthol, pentylenetetrazole, and pizotifen, which were purchased from Sigma-Aldrich.

Acetic acid (Dinâmica), diazepam (TemGenérico), diclofenac sodium (TemGenérico), DNase I (Thermo Fisher Scientific), DNA ladder (Ludwig Biotecnologia), ethanol (Dinâmica); NaCl (Neon), PCR Mastermix 2X (Thermo Scientific), saline solution (TemGenérico), Tween 80 (Dinâmica), TRIzol Reagent (Thermo Scientific), and ultrapure water (MilliQ system) were used.

Zebrafish

Adult wild zebrafish (Danio rerio; aZF) of both sexes (short-fin phenotype), aged 60 – 90 days, of similar size (3.5 ± 0.5 cm) and weight (0.3 ± 0.2 g) were obtained from Agroquímica: Comércio de Produtos Veterinários LTDA, a supplier located in Fortaleza (Ceará, Brazil). Groups of 50 fish were acclimated for 24 h in a 10 L glass tank (30 × 15 × 20 cm) containing dechlorinated tap water (ProtecPlus) and an air pump with a submerged filter at 25 °C and pH 7.0, under a near-normal circadian rhythm (14 : 10 h of light/dark cycle). The fish were fed ad libitum 24 h prior to the experiments. All experimental procedures were approved by the Ethics Committee on Animal Research of Ceará State University (CEUA-UECE; #7 210 149/2016).

General protocol

On the day of the experiment, aZF were randomly selected, then transferred to a wet sponge for treatment with the study drugs or controls, orally (p. o.), intraperitoneally (i. p.), or intramuscularly (i. m.), after which they were placed in individual beakers (250 mL) containing 150 mL of water from the fish tank and allowed to recover. For the oral treatments, a 20 µL variable pipette was used. An insulin syringe (0.5 mL; UltraFine BD) with a 30-gauge needle was used to inject the lips or for the intraperitoneal treatment [12].

The animals (n = 6/group) were pretreated with cis-jasmone (CJ) at 0.1 or 0.3 or 1.0 mg/mL (20 µL; p. o.) or vehicle (0.5% Tween 80 in saline; control; 20 µL; p. o.).

Evaluation of acute toxicity of cis-jasmone at the tested concentrations

The aZF were pretreated as described above and then each group was placed in separated aquariums. A group of animals without treatments (naive; n = 6) was included. Animal mortality was recorded at 48 h [38] after treatments, and the LC₅₀ value was determined through the trimmed Spearman–Karber test with confidence intervals of 95% [39].

Evaluation of the effect of cis-jasmone on the locomotor activity of adult zebrafish

The animals were submitted to an open field test [40] to assess whether CJ would promote, alone, changes in the motor coordination of fish, either by sedation and/or muscle relaxation.

The aZF were pretreated as described above. A group of animals (n = 6) was treated with diazepam (sedative control; DZP; 10 mg/mL; 20 µL; p. o.) and another without treatments (naïve) was also included. After one hour of the treatments, the animals were placed individually in Petri dishes (10 × 15 cm) containing the same water from the aquarium, divided into quadrants, and locomotor activity was analyzed by counting the number of crossing lines during 0 – 5 min.

Evaluation of cis-jasmone anticonvulsant activity

The aZF were pretreated as described above. A group of animals (n = 6) was treated with diazepam (positive control; DZP; 10 mg/mL; 20 µL; p. o.). After 1 h of the treatments, the animals were exposed individually in a 250 mL beaker containing 3.0 mM pentylenetetrazole (PTZ) [41] for analysis of the behavior similar to the seizure, which was classified according to each stage [42]: stage I – dramatically increased swimming activity; stage II – swirling swimming behavior; and stage III – clonus-like seizures, followed by loss of posture when the animal falls to one side and remains immobile for 1 – 3 s. The animals remained immersed in the solution containing PTZ until they reached stage III. Latencies for the first episode of seizure activity in stages I, II, and III were recorded in seconds.

In another set of experiments, the aZF were pretreated (20 µL; p. o.) with CJ (0.1 mg/mL) or vehicle (control) or flumazenil (0.1 mg/mL; i. p.) or diazepam (DZP; 10 mg/mL; 20 µL; p. o.). Other groups of animals (n = 6) received flumazenil 15 min before CJ or DZP. The experiment was carried out as described above 1 h after the last treatment.

Assessment of cis-jasmone anxiolytic-like activity

The aZF were pretreated with CJ or vehicle or diazepam (2.5 mg/mL; p. o.). A naive group (n = 6) was included. The test apparatus consisted of a half-black, half-white tank (30 cm × 15 cm × 20 cm) and a 3 cm water column. After 1 h, the fish were placed individually in the light area of a glass aquarium, in which the time spent in the light area was recorded after a 5-minute interval [18].

In a second experiment, the aZF were pretreated (20 µL; p. o.) with CJ (0.1 mg/mL), vehicle (control), diazepam (2.5 mg/mL) or flumazenil (0.1 mg/mL; i. p.). Two other groups of animals (n = 6/each) received flumazenil 15 min before CJ or diazepam. The experiment was carried out as described above 1 h after the last treatment. A naive group (n = 6) was included.

In a third experiment, the participation of the serotonergic system in the anxiolytic-like effect of CJ was evaluated [43]. The aZF were pretreated (20 µL; p. o.) with CJ (0.1 mg/mL), vehicle (control), cyproheptadine (0.8 mg/mL), pizotifen (0.8 mg/mL) or granisetron (0.5 mg/mL). Three other groups of animals (n = 6/each) received cyproheptadine, pizotifen, or granisetron 15 min before CJ. 1 h after the last treatment, the experiment was carried out as described above. A naive group (n = 6) was included.

Assessment of the anti-inflammatory activity of cis-jasmone

The aZF were pretreated with CJ or vehicle or diclofenac sodium (5.0 mg/mL; i. p.). After 30 min or 1 h, the animals received an intraperitoneal injection of carrageenan (1.5%; 20 µL; i. p.), and then rested in separate beakers. After 1 and 4 h of the application of carrageenan, the weights (P) of the animals were recorded and the difference between the initial and post-treatment weight was calculated [17].

Evaluation of cis-jasmone orofacial antinociceptive activity

The orofacial antinociceptive activity of cis-jasmone was carried out in the adult zebrafish according to Soares et al. [16].

Cinnamaldehyde-induced orofacial nociception

The aZF were pretreated with CJ or vehicle and after 1 h, orofacial nociception was induced by applying cinnamaldehyde (0.33 µM; 5.0 µL; i. m.) to the lips of the animals. Then, the animals were placed individually in Petri dishes and the nociceptive response was quantified in terms of locomotor activity (2.5) for 0 – 5 min. A naive group (n = 6) was included.

In a second experiment, the aZF were pretreated (20 µL; p. o.) with CJ (0.3 mg/mL), vehicle (control) or HC-030031 (TRPA1 antagonist; 0.1 mg/mL; i. p.). A fourth group of animals (n = 6) received HC-030031 15 min before CJ. One h after the last treatment, nociception was induced with cinnamaldehyde as described above. A naive group (n = 6) was included.

Capsaicin-induced orofacial nociception

The aZF were pretreated with CJ or vehicle. After 1 h, orofacial nociception was induced with capsaicin [40.93 µM – dissolved in ethanol, PBS (phosphate-buffered saline), and distilled water (1: 1: 8); 5.0 µL; i. m.] applied to the lips of the animals. Then, the animals were placed individually in Petri dishes and the nociceptive response was quantified in terms of locomotor activity for 10 to 20 min. A naive group (n = 6) was included.

In a second experiment, the aZF were pretreated (20 µL; p. o.) with CJ (0.1 mg/mL), vehicle (control) or capsazepine (TRPV1 antagonist; 30 nM; 20 µL; i. p.). A fourth group of animals (n = 6) received capsazepine 15 min before CJ. Nociception was induced with capsaicin as described above 1 h after the last treatment. A naive group (n = 6) was included.

Glutamate-induced orofacial nociception

The aZF were pretreated with CJ or vehicle. After 1 h, orofacial nociception was induced with glutamate (12.5 µM; 5.0 µL; i. m.) applied to the lips of animals. Then, the animals were placed individually in Petri dishes and the nociceptive response was quantified in terms of locomotor activity for 0 – 15 min. A naive group (n = 6) was included.

Menthol-induced orofacial nociception

The aZF were pretreated with CJ or vehicle. After 1 h, orofacial nociception was induced with menthol (1.2 mM; 5.0 µL; i. m.) applied to the lips of animals. Then, the animals were placed individually in Petri dishes and the nociceptive response was quantified in terms of locomotor activity for 0 – 10 min. A naive group (n = 6) was included.

Acidic saline-induced orofacial nociception

The aZF were pretreated with CJ or vehicle. After 1 h, orofacial nociception was induced with acidic saline (0.1% acetic acid in saline, pH 3.28; 5.0 µL; i. m.) applied to the lips of the animals. Then, the animals were placed individually in Petri dishes and the nociceptive response was quantified in terms of locomotor activity for 0 – 20 min. A naive group (n = 6) was included.

Evaluation of the involvement of central afferent fibers sensitive to cinnamaldehyde

The aZF were grouped (n = 6/group) in:

1. Control – (0.5% Tween 80 in saline; 20 µL; p. o.);

2. Desensitized control – cinnamaldehyde (0.33 µM; 20 µL; i. p.) administered at times 15, 30, 60, 120, and 240 min before control (0.5% Tween 80; 20 µL; p. o.);

3. CJ – (0.1 mg/mL; 20 µL; p. o.);

4. Desensitized cis-jasmone – cinnamaldehyde (0.33 µM; 20 µL; i. p.) administered at times 15, 30, 60, 120, and 240 min before CJ (0.1 mg/mL; 20 µL; p. o.).

Orofacial nociception was induced with capsaicin (40.93 µM; 5.0 µL; i. m.), injected into the lips of the animals, 1 h after these treatments (a – d). A naive group (n = 6) was included. The nociceptive behavior was evaluated as described above.

Evaluation of the involvement of central afferent fibers sensitive to capsaicin

Successive applications of capsaicin at pre-established intervals result in a decreased response of the nociceptive stimulus, causing a desensitization of type C afferent fibers in mammals [44]. In this study, the method proposed by Soares et al. [16] was used. The aZF were grouped (n = 6/group) in:

1. Control – (0.5% Tween 80 in saline; 20 µL; p. o.);

2. Desensitized control – capsaicin (40.93 µM; 20 µL; i. p.) administered at times 15, 30, 60, 120, and 240 min before control (0.5% Tween 80; 20 µL; p. o.);

3. CJ – (0.1 mg/mL; 20 µL; p. o.);

4. Desensitized cis-jasmone – capsaicin (40.93 µM; 20 µL; i. p.) administered at times 15, 30, 60, 120, and 240 min before CJ (0.1 mg/mL; 20 µL; p. o.).

Orofacial nociception was induced with glutamate (12.5 µM; 5.0 µL; i. m.), injected into the lips of the animals, 1 h after these treatments (a – d). A naive group (n = 6) was included. The nociceptive behavior was evaluated as described above.

Evaluation of the effect of cis-jasmone relative gene expression of TRPA1 and TRPV1 in the brain of the adult zebrafish

The aZF were pretreated (20 µL; p. o.) with CJ (0.1 mg/mL) and vehicle (control). After 1 h, orofacial nociception was induced with cinnamaldehyde (0.33 µM; 5.0 µL; i. m.) applied to the lips of the animals. After recording the nociceptive behavior, samples of cerebral tissue from all animals were collected and immediately stored in liquid nitrogen.

Total RNA was extracted using the TRIzol Reagent (Thermo Scientific, USA) according to the manufacturerʼs instructions. Approximately 500 to 1000 ng of total RNA were treated with DNase I (Thermo Scientific, USA) and reverse transcribed using the SuperScript III enzyme (Thermo Scientific, USA) and an oligodT primer. A pair of primers for the TRPV1 gene (TRPV1-F 5′ AGGGAACATACCTCAAGCCA 3′ and TRPV1-R 5′ GAGTCCATGGGCCTCTTGTC 3′) were designed to spam a 5413 bp intron and a 1073 bp intron of the TRPA1 gene (TRPA1-F 5′ TGTACGCCTCTCCATTACGC 3′ and TRPA1-R 5′ AGACCCTTCTCATCCCCCTC 3′) using the PrimerBlast Tool (https://www-ncbi-nlm-nih-gov.accesdistant.sorbonne-universite.fr/tools/primer-blast/). The elongation factor 1 alpha (Elfa) gene was chosen as the endogenous control (ELFA-F 5′ CTTCTCAGGCTGACTGTGC 3′ and ELFA-R 5′ CCGCTAGCATTACCCTCC 3′) [45]. The qRT-PCR was performed in triplicates using 0.2 µM of each primer, 1X Power SYBR Green PCR Mastermix (Thermo Scientific, Cat. n. 4 367 659), and 1 µL of cDNA. The reactions were incubated in a Step One Thermocycler (Applied Biosystems) for 95 °C for 10 min, followed by 50 cycles of 95 °C for 30 s, 55 °C for 30 s, and 72 °C for 30 s, followed by a melting curve. A water control reaction was performed for each primer. The 2^-ΔΔCT method was used to calculate relative gene expression levels [46].

Molecular docking study between cis-jasmone and TRPV1, TRPA1, and GABA_A receptors

The interaction between CJ and the TRPV1, TRPA1, and GABA_A channels was analyzed in silico by molecular docking simulation. The three-dimensional structures of the TRPV1, TRPA1, GABA_A receptors, and CJ are available from Protein Data Bank and PubChem (3J5P, 3J9P, 4COF, and 1 549 018, respectively). The docking was performed using the HEX 8.0 software [47], which adjusts automatically, based on the interaction energy between CJ and each possible interaction site present in the TRPV1, TRPA1, and GABA_A channels in certain locations and positions. The clusters provided were analyzed using PyMol v1.4.7, which allows a detailed investigation of the complexes formed: association energy, chemical bonding, involved amino acid residues, and conformational nuances. The parameters used in the software interface for the adaptation process were type of correlation (only form), calculation device (GPU-Graphical Process Units), FFT mode (fast 3D life), grid dimension (0.6), receiver range (180), binder band (180°), torsion range (360°), and distance range (40).

Statistical analysis

The results were expressed as mean values with 95% confidence interval (CI) for each group of six animals. After confirming the normality of distribution and data homogeneity, the differences between the groups were submitted to one-way analysis of variance (ANOVA), followed by Tukeyʼs test. The relative gene expression was analyzed using Mann–Whitney test. All analyses were performed with the software GraphPad Prism v. 6.01. The level of statistical significance was set at 5% (p < 0.05).

Contributorsʼ Statement

F. M. D. H. Bezerra, A. E. Vieira-Neto, S. C. Benevides, K. C. S. Tavares, A. D. C. Ribeiro, S. A. A. R. Santos, G. O. Leite, F. E. A. Magalhães; study design : A. R. Campos, F. E. A. Magalhães; statistical analysis: A. R. Campos, G. O. Leite, F. E. A. Magalhães; analysis and interpretation of the data: F. M. D. H. Bezerra, A. E. Vieira-Neto, K. C. S. Tavares, A. R. Campos, G. O. Leite, F. E. A. Magalhães; drafting of the manuscript: F. M. D. H. Bezerra, A. R. Campos, F. E. A. Magalhães; critical revision of the manuscript: A. R. Campos.

Conflict of Interest

The authors declare that they have no conflict of interest.

Acknowledgements

We would like to thank FUNCAP, CAPES, CNPq, and the Edson Queiroz Foundation for financial support and infrastructure.

• References

• 1 Lis-Balchin M, Hart S, Lo BWH. Jasmine absolute (Jasminum grandiflora L.) and its mode of action on guinea-pig ileum in vitro . Phytother Res 2002; 16: 437-439
  CrossrefPubMedSearch in Google Scholar
• 2 Kaviani M, Maghbool S, Azima S, Tabaei MH. Comparison of the effect of aromatherapy with Jasminum officinale and Salvia officinale on pain severity and labor outcome in nulliparous women. Iran J Nurs Midwifery Res 2014; 19: 666-672
  PubMedSearch in Google Scholar
• 3 Temraz A, Cionib PL, Flaminib G, Bracab A. Chemical composition of the essential oil from Jasminum pubescens Leaves and flowers. Natural Product Communications 2009; 4912: 1729-1732
  PubMedSearch in Google Scholar
• 4 Umukoro S, Olugbemide AS. Antinociceptive effects of methyl jasmonate in experimental animals. J Nat Med 2011; 65: 466-470
  CrossrefPubMedSearch in Google Scholar
• 5 OʼNeil MJ. (ed) The Merck Index. 15th ed. Cambridge, UK: Royal Society of Chemistry; 2013: 974
  Search in Google Scholar
• 6 Ai L, Hu J, Ji X, Zhao H. Structure confirmation and thermal kinetics of the inclusion of cis-jasmone in β-cyclodextrin. RSC advances 2019; 9: 26224-26229
  CrossrefPubMedSearch in Google Scholar
• 7 Knudsen JT, Eriksson R, Gershenzon J, Stahl B. Diversity and distribution of floral perfume. Bot Rev 2006; 72: 1-120
  CrossrefPubMedSearch in Google Scholar
• 8 Linares AMP, Hernandes C, Franca SC, Loutenco MV. Atividade fitorreguladora de jasmonatos produzidos por Botryosphaeria rhodina . Horticultura Brasileira 2010; 28: 430-434
  CrossrefPubMedSearch in Google Scholar
• 9 Silva AM, Soares CCG. A utilização do jasmim (Jasminum officinale) no combate à insônia. In: 54 °CONGRESSO DE QUÍMICA, Natal, Anais … Natal, Rio Grande do Norte, Brasil [s.n.]. 2014. Accessed January 25, 2923 at: http://www.abq.org.br/cbq/2014/trabalhos/7/5230-19365.html
  Search in Google Scholar
• 10 Carrera ALC, Moreno IF, Besson JCF, Natali MRM. Análise da resposta tecidual e atividade antineuroinflamatória colônica do metil jasmonato na retocolite ulcerativa crônica induzida por ácido trinitrobenzosulfônico em ratos. Iniciação Científica CESUMAR 2019; 21: 153-162
  CrossrefPubMedSearch in Google Scholar
• 11 Howe K, Clark MD, Torroja CF, Torrance J, Berthelot C, Muffato M, Collins JE, Humphray S, McLaren K, Matthews L, McLaren S, Sealy I, Caccamo M, Churcher C, Scott C, Barrett JC, Koch R, Rauch GJ, White S, Chow W, Kilian B, Quintais LT, Guerra-Assunção JA, Zhou Y, Gu Y, Yen J, Vogel JH, Eyre T, Redmond S, Banerjee R, Chi J, Fu B, Langley E, Maguire SF, Laird GK, Lloyd D, Kenyon E, Donaldson S, Sehra H, Almeida-King J, Loveland J, Trevanion S, Jones M, Quail M, Willey D, Hunt A, Burton J, Sims S, McLay K, Plumb B, Davis J, Clee C, Oliver K, Clark R, Riddle C, Elliot D, Threadgold G, Harden G, Ware D, Begum S, Mortimore B, Kerry G, Heath P, Phillimore B, Tracey A, Corby N, Dunn M, Johnson C, Wood J, Clark S, Pelan S, Griffiths G, Smith M, Glithero R, Howden P, Barker N, Lloyd C, Stevens C, Harley J, Holt K, Panagiotidis G, Lovell J, Beasley H, Henderson C, Gordon D, Auger K, Wright D, Collins J, Raisen C, Dyer L, Leung K, Robertson L, Ambridge K, Leongamornlert D, McGuire S, Gilderthorp R, Griffiths C, Manthravadi D, Nichol S, Barker G, Whitehead S, Kay M, Brown J, Murnane C, Gray E, Humphries M, Sycamore N, Barker D, Saunders D, Wallis J, Babbage A, Hammond S, Mashreghi-Mohammadi M, Barr L, Martin S, Wray P, Ellington A, Matthews N, Ellwood M, Woodmansey R, Clark G, Cooper J, Tromans A, Grafham D, Skuce C, Pandian R, Andrews R, Harrison E, Kimberley A, Garnett J, Fosker N, Hall R, Garner P, Kelly D, Bird C, Palmer S, Gehring I, Berger A, Dooley CM, Ersan-Ürün Z, Eser C, Geiger H, Geisler M, Karotki L, Kirn A, Konantz J, Konantz M, Oberländer M, Rudolph-Geiger S, Teucke M, Lanz C, Raddatz G, Osoegawa K, Zhu B, Rapp A, Widaa S, Langford C, Yang F, Schuster SC, Carter NP, Harrow J, Ning Z, Herrero J, Searle SM, Enright A, Geisler R, Plasterk RH, Lee C, Westerfield M, de Jong PJ, Zon LI, Postlethwait JH, Nüsslein-Volhard C, Hubbard TJ, Roest Crollius H, Rogers J, Stemple DL. The zebrafish reference genome sequence and its relationship to the human genome. Nature 2013; 496: 498-503
  CrossrefPubMedSearch in Google Scholar
• 12 Magalhães FEA, de Sousa CÁPB, Santos SAAR, Menezes RB, Batista FLA, Abreu ÂO, de Oliveira MV, Moura LFWG, Raposo RDS, Campos AR. Adult zebrafish (Danio rerio): an alternative behavioral model of formalin-Induced nociception. Zebrafish 2017; 14: 422-429
  CrossrefPubMedSearch in Google Scholar
• 13 Lima MCL, de Araújo JIF, Mota CG, Magalhães FEA, Campos AR, da Silva PT, Rodrigues THS, Matos MGC, de Sousa KC, de Sousa MB, Saker-Sampaio S, Pereira AL, Texeira EH, dos Santos HS. Antinociceptive effect of the essential oil Of Schinus terebinthifolius (female) leaves on adult zebrafish (Danio rerio). Zebrafish 2020; 17: 112-119
  CrossrefPubMedSearch in Google Scholar
• 14 Magalhães FEA, Batista FLA, Lima LMG, Abrante IA, Batista FLA, Abrante IA, de Araújo JIF, Santos SAAR, de Oliveira BA, Raposo RS, Campos AR. Adult zebrafish (Danio rerio) as a model for the study of corneal antinociceptive compounds. Zebrafish 2018; 5: 566-574
  CrossrefPubMedSearch in Google Scholar
• 15 do Nascimento JET, de Morais SM, de Lisboa DS, Sousa MO, Santos SAAR, Magalhães FEA, Campos AR. The orofacial antinociceptive effect of kaempferol-3-O-rutinoside, isolated from the plant Ouratea fieldingiana, on adult zebrafish (Danio rerio). Biomed Pharmacother 2018; 107: 1030-1036
  CrossrefPubMedSearch in Google Scholar
• 16 Soares ICR, Santos SAAR, Coelho RF, Alves YA, Vieira-Neto AE, Tavares KCS, Magalhães FEA, Campos AR. Oleanolic acid promotes orofacial antinociception in adult zebrafish (Danio rerio) through TRPV1 receptors. Chemico-Biological Interactions 2019; 299: 37-43
  CrossrefPubMedSearch in Google Scholar
• 17 Huang SY, Feng CW, Hung HC, Chakraborty C, Chen CH, Chen WF, Jean YH, Wang HM, Sung CS, Sun YM, Wu CY, Liu W, Hsiao CD, Wen ZH. A novel zebrafish model to provide mechanistic insights into the inflammatory events in carrageenan-induced abdominal edema. PLoS One 2014; 9: e104414
  CrossrefPubMedSearch in Google Scholar
• 18 Gebauer DL, Pagnussat N, Piato AL, Schaefer IC, Bonan CD, Lara DR. Effects of anxiolytics in zebrafish: similarities and differences between benzodiazepines, buspirone and ethanol. Pharmacol Biochem Behav 2011; 99: 480-486
  CrossrefPubMedSearch in Google Scholar
• 19 da Silva AW, Ferreira MKA, Rebouças EL, Silva FCO, Holanda CLA, Barroso SM, Batista FLA, Mendes FRS, Campos AR, de Menezes JASA, Magalhães FEA, Siqueira SMC, dos Santos HS. Anxiolytic-like effect of Azadirachta indica A. Juss. (Neem, Meliaceae) bark on adult zebrafish (Danio rerio): participation of the serotoninergic and GABAergic systems. Pharm Pharmacol Int J 2020; 8: 256-263
  CrossrefPubMedSearch in Google Scholar
• 20 Mrazova A, Sam KA. Application of methyl jasmonate to grey willow (Salix cinerea) attracts insectivorous birds in nature. Arthropod-Plant Interactions 2018; 12: 1-8
  CrossrefPubMedSearch in Google Scholar
• 21 Cachat J, Stewart A, Utterback E, Hart P, Gaikwad S, Wong K. Three-dimensional neurophenotyping of adult zebrafish behavior. PLoS One 2011; 6: 17597-17610
  CrossrefPubMedSearch in Google Scholar
• 22 Taylor JC, Dewberry LS, Totsch SK, Yessick LR, DeBerry JJ, Watts SA, Sorge RE. A novel zebrafish-based model of nociception. Physiology and Behavior 2017; 174: 83-88
  CrossrefPubMedSearch in Google Scholar
• 23 Greenfield jr. LJ. Molecular mechanisms of antiseizure drug activity at GAGA_A receptors. Seizure 2013; 22: 589-600
  CrossrefPubMedSearch in Google Scholar
• 24 Betts T. Use of aromatherapy (with or without hypnosis) in the treatment of intractable epilepsy a two year follow up study. Seizure 2003; 12: 534-538
  CrossrefPubMedSearch in Google Scholar
• 25 Hossain SJ, Aoshima H, Koda H, Kiso Y. Fragrances in oolong tea that enhance the response of GABA_A receptors. Biosci Biotechnol Biochem 2004; 68: 1842-1848
  CrossrefPubMedSearch in Google Scholar
• 26 Bourin M, Hascoet M. The mouse light-dark box test. Eur J Pharmacol 2003; 463: 55-65
  CrossrefPubMedSearch in Google Scholar
• 27 Barcellos HHA. Efeitos neuroendócrinos e comportamentais do aripiprazol em zebrafish. [Dissertação: Mestrado em Farmacologia]. Santa Maria: Universidade Federal de Santa Maria; 2019
  Search in Google Scholar
• 28 de Moura Fé TC. Cis-Jasmona: potencial fitofármaco para o tratamento da dermatite atópica em modelo animal. [Dissertação: Mestrado em Ciências Médica]. Fortaleza: Universidade de Fortaleza; 2019
  Search in Google Scholar
• 29 Poluha RL, Grossmann E. Inflammatory mediators related to arthrogenic temporomandibular dysfunctions. Br J Pain 2018; 1: 60-65
  PubMedSearch in Google Scholar
• 30 Saito S, Tominaga M. Evolutionary tuning of TRPA1 and TRPV1 thermal and chemical sensitivity in vertebrates. Temperature 2017; 4: 141-152
  CrossrefPubMedSearch in Google Scholar
• 31 Ho KW, Ward NJ, Calkins DL. TRPV1: a stress response protein in the central nervous system. Am J Neurodegener Dis 2012; 1: 1-14
  PubMedSearch in Google Scholar
• 32 Meents JE, Ciotu CI, Fischer MJM. TRPA1: a molecular view. J Neurophysiol 2019; 121: 427-443
  CrossrefPubMedSearch in Google Scholar
• 33 Verleye M, Schlichter R, Gillardin JM. Interactions of etifoxine with the chloride channel coupled to the GABA_A receptor complex. Neuroreport 1999; 10: 3207-3210
  CrossrefPubMedSearch in Google Scholar
• 34 Story GM, Peier AM, Reeve AJ, Eid SR, Mosbacher J, Hricik TR, Earley TJ, Hergarden AC, Andersson DA, Hwangs SW, Mcintyre P, Jegla T, Bevan S, Patapoutian A. ANKTM1, a TRP-like channel expressed in nociceptive neurons, is activated by cold temperatures. Cell 2003; 112: 819-829
  CrossrefPubMedSearch in Google Scholar
• 35 Chung MK, Ro JY. Peripheral glutamate receptor and transient receptor potential channel mechanisms of craniofacial muscle pain. Molecular Pain 2020; 16: 1-10
  CrossrefPubMedSearch in Google Scholar
• 36 Diogenes A, Akopian AN, Hargreaves KM. NGF up-regulates TRPA1: implications for orofacial pain. J Dent Res 2007; 86: 550-555
  CrossrefPubMedSearch in Google Scholar
• 37 Hossain MZ, Bakri MM, Yahya F, Ando H, Unno S, Kitagawa J. The role of transient receptor potential (TRP) channels in the transduction of dental pain. International Journal of Molecular Sciences 2019; 20: 526-556
  CrossrefPubMedSearch in Google Scholar
• 38 Polat H, Erkoç FU, Viran R, Koçak O. Investigation of acute toxicity of beta-cypermethrin on guppies Poecilia reticulata. Chemosphere 2002; 49: 39-44
  CrossrefPubMedSearch in Google Scholar
• 39 Arellano-Aguilar O, Solis-Angeles S, Serrano-Garcia L, Morales-Sierra E, Mendez-Serrano A, Monteo-Montoya R. Use of the zebrafish embryo toxicity test for risk assessment purpose: Case study. Fish Sci 2015; 9: 52-62
  PubMedSearch in Google Scholar
• 40 Ahmad F, Richardson MK. Exploratory behaviour in the open field test adapted for larval zebrafish: Impact of environmental complexity. Behav Processes 2013; 92: 88-98
  CrossrefPubMedSearch in Google Scholar
• 41 Siebel AMD, Menezes FP, Schaefer IC, Petersen BD, Bonan DC. Rapamycin suppresses PTZ-induced seizures at different developmental stages of zebrafish. Pharmacol Biochem Behav 2015; 139: 163-168
  CrossrefPubMedSearch in Google Scholar
• 42 Pineda R, Beattie CE, Hall CW. Recording the adult zebrafish cerebral field potential during pentylenetetrazole seizures. J Neurosci Methods 2011; 200: 20-28
  CrossrefPubMedSearch in Google Scholar
• 43 Benneh CK, Biney RP, Mante PK, Tandoh A, Adongo DW, Wood E. Maerua angolensis stem bark extract reverses anxiety and related behaviours in zebrafish-Involvement of GABAergic and 5-HT systems. J Ethnopharmacol 2017; 207: 129-145
  CrossrefPubMedSearch in Google Scholar
• 44 Sakurada T, Matsumura T, Moriyama T, Sakurada C, Ueno S, Sakurada S. Differential effects of intraplantar capsazepine and ruthenium red on capsaicin-induced desensitization in mice. Phamacol Biochem Behav 2003; 75: 115-121
  CrossrefPubMedSearch in Google Scholar
• 45 McCurley AT, Callard GV. Characterization of housekeeping genes in zebrafish: Male-female differences and effects of tissue type, developmental stage and chemical treatment. BMC Molecular Biology 2008; 9: 102-113
  CrossrefPubMedSearch in Google Scholar
• 46 Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2[-Delta Delta C(T)] Method. Methods 2001; 25: 402-408
  CrossrefPubMedSearch in Google Scholar
• 47 Macindoe G, Mavridis L, Venkatraman V, Devignes MD, Rritchie DW. HexServer: An FFT-based protein docking server powered by graphics processors. Nucleic Acids Research 2010; 38: 445-449
  CrossrefPubMedSearch in Google Scholar

Correspondence

Publication History

Received: 03 March 2022

Accepted after revision: 18 November 2022

Article published online:
31 January 2023

© 2023. Thieme. All rights reserved.

Georg Thieme Verlag KG
Rüdigerstraße 14, 70469 Stuttgart, Germany

• References

• 1 Lis-Balchin M, Hart S, Lo BWH. Jasmine absolute (Jasminum grandiflora L.) and its mode of action on guinea-pig ileum in vitro . Phytother Res 2002; 16: 437-439
  CrossrefPubMedSearch in Google Scholar
• 2 Kaviani M, Maghbool S, Azima S, Tabaei MH. Comparison of the effect of aromatherapy with Jasminum officinale and Salvia officinale on pain severity and labor outcome in nulliparous women. Iran J Nurs Midwifery Res 2014; 19: 666-672
  PubMedSearch in Google Scholar
• 3 Temraz A, Cionib PL, Flaminib G, Bracab A. Chemical composition of the essential oil from Jasminum pubescens Leaves and flowers. Natural Product Communications 2009; 4912: 1729-1732
  PubMedSearch in Google Scholar
• 4 Umukoro S, Olugbemide AS. Antinociceptive effects of methyl jasmonate in experimental animals. J Nat Med 2011; 65: 466-470
  CrossrefPubMedSearch in Google Scholar
• 5 OʼNeil MJ. (ed) The Merck Index. 15th ed. Cambridge, UK: Royal Society of Chemistry; 2013: 974
  Search in Google Scholar
• 6 Ai L, Hu J, Ji X, Zhao H. Structure confirmation and thermal kinetics of the inclusion of cis-jasmone in β-cyclodextrin. RSC advances 2019; 9: 26224-26229
  CrossrefPubMedSearch in Google Scholar
• 7 Knudsen JT, Eriksson R, Gershenzon J, Stahl B. Diversity and distribution of floral perfume. Bot Rev 2006; 72: 1-120
  CrossrefPubMedSearch in Google Scholar
• 8 Linares AMP, Hernandes C, Franca SC, Loutenco MV. Atividade fitorreguladora de jasmonatos produzidos por Botryosphaeria rhodina . Horticultura Brasileira 2010; 28: 430-434
  CrossrefPubMedSearch in Google Scholar
• 9 Silva AM, Soares CCG. A utilização do jasmim (Jasminum officinale) no combate à insônia. In: 54 °CONGRESSO DE QUÍMICA, Natal, Anais … Natal, Rio Grande do Norte, Brasil [s.n.]. 2014. Accessed January 25, 2923 at: http://www.abq.org.br/cbq/2014/trabalhos/7/5230-19365.html
  Search in Google Scholar
• 10 Carrera ALC, Moreno IF, Besson JCF, Natali MRM. Análise da resposta tecidual e atividade antineuroinflamatória colônica do metil jasmonato na retocolite ulcerativa crônica induzida por ácido trinitrobenzosulfônico em ratos. Iniciação Científica CESUMAR 2019; 21: 153-162
  CrossrefPubMedSearch in Google Scholar
• 11 Howe K, Clark MD, Torroja CF, Torrance J, Berthelot C, Muffato M, Collins JE, Humphray S, McLaren K, Matthews L, McLaren S, Sealy I, Caccamo M, Churcher C, Scott C, Barrett JC, Koch R, Rauch GJ, White S, Chow W, Kilian B, Quintais LT, Guerra-Assunção JA, Zhou Y, Gu Y, Yen J, Vogel JH, Eyre T, Redmond S, Banerjee R, Chi J, Fu B, Langley E, Maguire SF, Laird GK, Lloyd D, Kenyon E, Donaldson S, Sehra H, Almeida-King J, Loveland J, Trevanion S, Jones M, Quail M, Willey D, Hunt A, Burton J, Sims S, McLay K, Plumb B, Davis J, Clee C, Oliver K, Clark R, Riddle C, Elliot D, Threadgold G, Harden G, Ware D, Begum S, Mortimore B, Kerry G, Heath P, Phillimore B, Tracey A, Corby N, Dunn M, Johnson C, Wood J, Clark S, Pelan S, Griffiths G, Smith M, Glithero R, Howden P, Barker N, Lloyd C, Stevens C, Harley J, Holt K, Panagiotidis G, Lovell J, Beasley H, Henderson C, Gordon D, Auger K, Wright D, Collins J, Raisen C, Dyer L, Leung K, Robertson L, Ambridge K, Leongamornlert D, McGuire S, Gilderthorp R, Griffiths C, Manthravadi D, Nichol S, Barker G, Whitehead S, Kay M, Brown J, Murnane C, Gray E, Humphries M, Sycamore N, Barker D, Saunders D, Wallis J, Babbage A, Hammond S, Mashreghi-Mohammadi M, Barr L, Martin S, Wray P, Ellington A, Matthews N, Ellwood M, Woodmansey R, Clark G, Cooper J, Tromans A, Grafham D, Skuce C, Pandian R, Andrews R, Harrison E, Kimberley A, Garnett J, Fosker N, Hall R, Garner P, Kelly D, Bird C, Palmer S, Gehring I, Berger A, Dooley CM, Ersan-Ürün Z, Eser C, Geiger H, Geisler M, Karotki L, Kirn A, Konantz J, Konantz M, Oberländer M, Rudolph-Geiger S, Teucke M, Lanz C, Raddatz G, Osoegawa K, Zhu B, Rapp A, Widaa S, Langford C, Yang F, Schuster SC, Carter NP, Harrow J, Ning Z, Herrero J, Searle SM, Enright A, Geisler R, Plasterk RH, Lee C, Westerfield M, de Jong PJ, Zon LI, Postlethwait JH, Nüsslein-Volhard C, Hubbard TJ, Roest Crollius H, Rogers J, Stemple DL. The zebrafish reference genome sequence and its relationship to the human genome. Nature 2013; 496: 498-503
  CrossrefPubMedSearch in Google Scholar
• 12 Magalhães FEA, de Sousa CÁPB, Santos SAAR, Menezes RB, Batista FLA, Abreu ÂO, de Oliveira MV, Moura LFWG, Raposo RDS, Campos AR. Adult zebrafish (Danio rerio): an alternative behavioral model of formalin-Induced nociception. Zebrafish 2017; 14: 422-429
  CrossrefPubMedSearch in Google Scholar
• 13 Lima MCL, de Araújo JIF, Mota CG, Magalhães FEA, Campos AR, da Silva PT, Rodrigues THS, Matos MGC, de Sousa KC, de Sousa MB, Saker-Sampaio S, Pereira AL, Texeira EH, dos Santos HS. Antinociceptive effect of the essential oil Of Schinus terebinthifolius (female) leaves on adult zebrafish (Danio rerio). Zebrafish 2020; 17: 112-119
  CrossrefPubMedSearch in Google Scholar
• 14 Magalhães FEA, Batista FLA, Lima LMG, Abrante IA, Batista FLA, Abrante IA, de Araújo JIF, Santos SAAR, de Oliveira BA, Raposo RS, Campos AR. Adult zebrafish (Danio rerio) as a model for the study of corneal antinociceptive compounds. Zebrafish 2018; 5: 566-574
  CrossrefPubMedSearch in Google Scholar
• 15 do Nascimento JET, de Morais SM, de Lisboa DS, Sousa MO, Santos SAAR, Magalhães FEA, Campos AR. The orofacial antinociceptive effect of kaempferol-3-O-rutinoside, isolated from the plant Ouratea fieldingiana, on adult zebrafish (Danio rerio). Biomed Pharmacother 2018; 107: 1030-1036
  CrossrefPubMedSearch in Google Scholar
• 16 Soares ICR, Santos SAAR, Coelho RF, Alves YA, Vieira-Neto AE, Tavares KCS, Magalhães FEA, Campos AR. Oleanolic acid promotes orofacial antinociception in adult zebrafish (Danio rerio) through TRPV1 receptors. Chemico-Biological Interactions 2019; 299: 37-43
  CrossrefPubMedSearch in Google Scholar
• 17 Huang SY, Feng CW, Hung HC, Chakraborty C, Chen CH, Chen WF, Jean YH, Wang HM, Sung CS, Sun YM, Wu CY, Liu W, Hsiao CD, Wen ZH. A novel zebrafish model to provide mechanistic insights into the inflammatory events in carrageenan-induced abdominal edema. PLoS One 2014; 9: e104414
  CrossrefPubMedSearch in Google Scholar
• 18 Gebauer DL, Pagnussat N, Piato AL, Schaefer IC, Bonan CD, Lara DR. Effects of anxiolytics in zebrafish: similarities and differences between benzodiazepines, buspirone and ethanol. Pharmacol Biochem Behav 2011; 99: 480-486
  CrossrefPubMedSearch in Google Scholar
• 19 da Silva AW, Ferreira MKA, Rebouças EL, Silva FCO, Holanda CLA, Barroso SM, Batista FLA, Mendes FRS, Campos AR, de Menezes JASA, Magalhães FEA, Siqueira SMC, dos Santos HS. Anxiolytic-like effect of Azadirachta indica A. Juss. (Neem, Meliaceae) bark on adult zebrafish (Danio rerio): participation of the serotoninergic and GABAergic systems. Pharm Pharmacol Int J 2020; 8: 256-263
  CrossrefPubMedSearch in Google Scholar
• 20 Mrazova A, Sam KA. Application of methyl jasmonate to grey willow (Salix cinerea) attracts insectivorous birds in nature. Arthropod-Plant Interactions 2018; 12: 1-8
  CrossrefPubMedSearch in Google Scholar
• 21 Cachat J, Stewart A, Utterback E, Hart P, Gaikwad S, Wong K. Three-dimensional neurophenotyping of adult zebrafish behavior. PLoS One 2011; 6: 17597-17610
  CrossrefPubMedSearch in Google Scholar
• 22 Taylor JC, Dewberry LS, Totsch SK, Yessick LR, DeBerry JJ, Watts SA, Sorge RE. A novel zebrafish-based model of nociception. Physiology and Behavior 2017; 174: 83-88
  CrossrefPubMedSearch in Google Scholar
• 23 Greenfield jr. LJ. Molecular mechanisms of antiseizure drug activity at GAGA_A receptors. Seizure 2013; 22: 589-600
  CrossrefPubMedSearch in Google Scholar
• 24 Betts T. Use of aromatherapy (with or without hypnosis) in the treatment of intractable epilepsy a two year follow up study. Seizure 2003; 12: 534-538
  CrossrefPubMedSearch in Google Scholar
• 25 Hossain SJ, Aoshima H, Koda H, Kiso Y. Fragrances in oolong tea that enhance the response of GABA_A receptors. Biosci Biotechnol Biochem 2004; 68: 1842-1848
  CrossrefPubMedSearch in Google Scholar
• 26 Bourin M, Hascoet M. The mouse light-dark box test. Eur J Pharmacol 2003; 463: 55-65
  CrossrefPubMedSearch in Google Scholar
• 27 Barcellos HHA. Efeitos neuroendócrinos e comportamentais do aripiprazol em zebrafish. [Dissertação: Mestrado em Farmacologia]. Santa Maria: Universidade Federal de Santa Maria; 2019
  Search in Google Scholar
• 28 de Moura Fé TC. Cis-Jasmona: potencial fitofármaco para o tratamento da dermatite atópica em modelo animal. [Dissertação: Mestrado em Ciências Médica]. Fortaleza: Universidade de Fortaleza; 2019
  Search in Google Scholar
• 29 Poluha RL, Grossmann E. Inflammatory mediators related to arthrogenic temporomandibular dysfunctions. Br J Pain 2018; 1: 60-65
  PubMedSearch in Google Scholar
• 30 Saito S, Tominaga M. Evolutionary tuning of TRPA1 and TRPV1 thermal and chemical sensitivity in vertebrates. Temperature 2017; 4: 141-152
  CrossrefPubMedSearch in Google Scholar
• 31 Ho KW, Ward NJ, Calkins DL. TRPV1: a stress response protein in the central nervous system. Am J Neurodegener Dis 2012; 1: 1-14
  PubMedSearch in Google Scholar
• 32 Meents JE, Ciotu CI, Fischer MJM. TRPA1: a molecular view. J Neurophysiol 2019; 121: 427-443
  CrossrefPubMedSearch in Google Scholar
• 33 Verleye M, Schlichter R, Gillardin JM. Interactions of etifoxine with the chloride channel coupled to the GABA_A receptor complex. Neuroreport 1999; 10: 3207-3210
  CrossrefPubMedSearch in Google Scholar
• 34 Story GM, Peier AM, Reeve AJ, Eid SR, Mosbacher J, Hricik TR, Earley TJ, Hergarden AC, Andersson DA, Hwangs SW, Mcintyre P, Jegla T, Bevan S, Patapoutian A. ANKTM1, a TRP-like channel expressed in nociceptive neurons, is activated by cold temperatures. Cell 2003; 112: 819-829
  CrossrefPubMedSearch in Google Scholar
• 35 Chung MK, Ro JY. Peripheral glutamate receptor and transient receptor potential channel mechanisms of craniofacial muscle pain. Molecular Pain 2020; 16: 1-10
  CrossrefPubMedSearch in Google Scholar
• 36 Diogenes A, Akopian AN, Hargreaves KM. NGF up-regulates TRPA1: implications for orofacial pain. J Dent Res 2007; 86: 550-555
  CrossrefPubMedSearch in Google Scholar
• 37 Hossain MZ, Bakri MM, Yahya F, Ando H, Unno S, Kitagawa J. The role of transient receptor potential (TRP) channels in the transduction of dental pain. International Journal of Molecular Sciences 2019; 20: 526-556
  CrossrefPubMedSearch in Google Scholar
• 38 Polat H, Erkoç FU, Viran R, Koçak O. Investigation of acute toxicity of beta-cypermethrin on guppies Poecilia reticulata. Chemosphere 2002; 49: 39-44
  CrossrefPubMedSearch in Google Scholar
• 39 Arellano-Aguilar O, Solis-Angeles S, Serrano-Garcia L, Morales-Sierra E, Mendez-Serrano A, Monteo-Montoya R. Use of the zebrafish embryo toxicity test for risk assessment purpose: Case study. Fish Sci 2015; 9: 52-62
  PubMedSearch in Google Scholar
• 40 Ahmad F, Richardson MK. Exploratory behaviour in the open field test adapted for larval zebrafish: Impact of environmental complexity. Behav Processes 2013; 92: 88-98
  CrossrefPubMedSearch in Google Scholar
• 41 Siebel AMD, Menezes FP, Schaefer IC, Petersen BD, Bonan DC. Rapamycin suppresses PTZ-induced seizures at different developmental stages of zebrafish. Pharmacol Biochem Behav 2015; 139: 163-168
  CrossrefPubMedSearch in Google Scholar
• 42 Pineda R, Beattie CE, Hall CW. Recording the adult zebrafish cerebral field potential during pentylenetetrazole seizures. J Neurosci Methods 2011; 200: 20-28
  CrossrefPubMedSearch in Google Scholar
• 43 Benneh CK, Biney RP, Mante PK, Tandoh A, Adongo DW, Wood E. Maerua angolensis stem bark extract reverses anxiety and related behaviours in zebrafish-Involvement of GABAergic and 5-HT systems. J Ethnopharmacol 2017; 207: 129-145
  CrossrefPubMedSearch in Google Scholar
• 44 Sakurada T, Matsumura T, Moriyama T, Sakurada C, Ueno S, Sakurada S. Differential effects of intraplantar capsazepine and ruthenium red on capsaicin-induced desensitization in mice. Phamacol Biochem Behav 2003; 75: 115-121
  CrossrefPubMedSearch in Google Scholar
• 45 McCurley AT, Callard GV. Characterization of housekeeping genes in zebrafish: Male-female differences and effects of tissue type, developmental stage and chemical treatment. BMC Molecular Biology 2008; 9: 102-113
  CrossrefPubMedSearch in Google Scholar
• 46 Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2[-Delta Delta C(T)] Method. Methods 2001; 25: 402-408
  CrossrefPubMedSearch in Google Scholar
• 47 Macindoe G, Mavridis L, Venkatraman V, Devignes MD, Rritchie DW. HexServer: An FFT-based protein docking server powered by graphics processors. Nucleic Acids Research 2010; 38: 445-449
  CrossrefPubMedSearch in Google Scholar